ID: 998397339

View in Genome Browser
Species Human (GRCh38)
Location 5:141827137-141827159
Sequence CCTGCTGGTTGGAGACATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397331_998397339 17 Left 998397331 5:141827097-141827119 CCACCTGAGTTCACTCTTGCCTC No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data
998397330_998397339 20 Left 998397330 5:141827094-141827116 CCTCCACCTGAGTTCACTCTTGC No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data
998397332_998397339 14 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data
998397335_998397339 -2 Left 998397335 5:141827116-141827138 CCTCGTGGCATGTTAAAGGCACC No data
Right 998397339 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397339 Original CRISPR CCTGCTGGTTGGAGACATTG AGG Intergenic
No off target data available for this crispr