ID: 998397342

View in Genome Browser
Species Human (GRCh38)
Location 5:141827153-141827175
Sequence ATTGAGGAAGACAGGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998397332_998397342 30 Left 998397332 5:141827100-141827122 CCTGAGTTCACTCTTGCCTCGTG No data
Right 998397342 5:141827153-141827175 ATTGAGGAAGACAGGACAGGTGG No data
998397335_998397342 14 Left 998397335 5:141827116-141827138 CCTCGTGGCATGTTAAAGGCACC No data
Right 998397342 5:141827153-141827175 ATTGAGGAAGACAGGACAGGTGG No data
998397338_998397342 -7 Left 998397338 5:141827137-141827159 CCTGCTGGTTGGAGACATTGAGG No data
Right 998397342 5:141827153-141827175 ATTGAGGAAGACAGGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998397342 Original CRISPR ATTGAGGAAGACAGGACAGG TGG Intergenic
No off target data available for this crispr