ID: 998400368

View in Genome Browser
Species Human (GRCh38)
Location 5:141845707-141845729
Sequence GTGTGAAGGGGGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998400368_998400383 15 Left 998400368 5:141845707-141845729 CCACCCACCCTCCCCCTTCACAC No data
Right 998400383 5:141845745-141845767 CCCTCCCCGACTGTCTTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998400368 Original CRISPR GTGTGAAGGGGGAGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr