ID: 998400691

View in Genome Browser
Species Human (GRCh38)
Location 5:141847359-141847381
Sequence GAGTAGAAATGGAGGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998400691_998400700 27 Left 998400691 5:141847359-141847381 CCAACTCCCCTCCATTTCTACTC No data
Right 998400700 5:141847409-141847431 AAACCCAGGTAACTGCCCTGAGG No data
998400691_998400699 13 Left 998400691 5:141847359-141847381 CCAACTCCCCTCCATTTCTACTC No data
Right 998400699 5:141847395-141847417 GGTTAGAAGAAAAGAAACCCAGG No data
998400691_998400696 -8 Left 998400691 5:141847359-141847381 CCAACTCCCCTCCATTTCTACTC No data
Right 998400696 5:141847374-141847396 TTCTACTCACTTTGCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998400691 Original CRISPR GAGTAGAAATGGAGGGGAGT TGG (reversed) Intergenic
No off target data available for this crispr