ID: 998402546 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:141855541-141855563 |
| Sequence | CTCTATCCTCAGATGAAATT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998402539_998402546 | 30 | Left | 998402539 | 5:141855488-141855510 | CCCTCTCACACACACAGATAGGC | 0: 1 1: 0 2: 3 3: 36 4: 639 |
||
| Right | 998402546 | 5:141855541-141855563 | CTCTATCCTCAGATGAAATTGGG | No data | ||||
| 998402540_998402546 | 29 | Left | 998402540 | 5:141855489-141855511 | CCTCTCACACACACAGATAGGCA | 0: 1 1: 0 2: 2 3: 108 4: 1067 |
||
| Right | 998402546 | 5:141855541-141855563 | CTCTATCCTCAGATGAAATTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998402546 | Original CRISPR | CTCTATCCTCAGATGAAATT GGG | Intronic | ||
| No off target data available for this crispr | |||||