ID: 998402546

View in Genome Browser
Species Human (GRCh38)
Location 5:141855541-141855563
Sequence CTCTATCCTCAGATGAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998402539_998402546 30 Left 998402539 5:141855488-141855510 CCCTCTCACACACACAGATAGGC 0: 1
1: 0
2: 3
3: 36
4: 639
Right 998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG No data
998402540_998402546 29 Left 998402540 5:141855489-141855511 CCTCTCACACACACAGATAGGCA 0: 1
1: 0
2: 2
3: 108
4: 1067
Right 998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998402546 Original CRISPR CTCTATCCTCAGATGAAATT GGG Intronic
No off target data available for this crispr