ID: 998404922

View in Genome Browser
Species Human (GRCh38)
Location 5:141868879-141868901
Sequence CTGGCTTCAGACCGTGATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998404922_998404933 21 Left 998404922 5:141868879-141868901 CCAGCATCACGGTCTGAAGCCAG 0: 1
1: 0
2: 3
3: 7
4: 122
Right 998404933 5:141868923-141868945 GATGTTGGTGTTCTCAGGGATGG 0: 1
1: 0
2: 3
3: 36
4: 259
998404922_998404931 17 Left 998404922 5:141868879-141868901 CCAGCATCACGGTCTGAAGCCAG 0: 1
1: 0
2: 3
3: 7
4: 122
Right 998404931 5:141868919-141868941 AGCCGATGTTGGTGTTCTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 101
998404922_998404929 6 Left 998404922 5:141868879-141868901 CCAGCATCACGGTCTGAAGCCAG 0: 1
1: 0
2: 3
3: 7
4: 122
Right 998404929 5:141868908-141868930 GGGGAAGAGTGAGCCGATGTTGG 0: 1
1: 0
2: 0
3: 12
4: 161
998404922_998404930 16 Left 998404922 5:141868879-141868901 CCAGCATCACGGTCTGAAGCCAG 0: 1
1: 0
2: 3
3: 7
4: 122
Right 998404930 5:141868918-141868940 GAGCCGATGTTGGTGTTCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998404922 Original CRISPR CTGGCTTCAGACCGTGATGC TGG (reversed) Exonic
902797846 1:18810794-18810816 CTGGCATTAGACTGGGATGCAGG - Intergenic
905974253 1:42163783-42163805 CTGGCTTGGCTCCGTGATGCTGG + Intronic
908508409 1:64829147-64829169 CTGGCTTCTGACAGTGAAGATGG + Intronic
911118658 1:94272742-94272764 GAGCCTTCAGACTGTGATGCAGG - Intronic
919662069 1:200257108-200257130 CTGCCTTCAGACCTTGCGGCAGG + Intergenic
922204669 1:223436080-223436102 AAGGCTTCAGACTGTGATGCTGG + Intergenic
923656870 1:235924437-235924459 CTGGCTGCAGAATTTGATGCGGG - Intergenic
924417730 1:243876020-243876042 CTGGCTTCACACAGTTATGTAGG - Intergenic
1067799837 10:49351338-49351360 CAGGCTTCAGGCAGTGTTGCGGG + Intergenic
1068950258 10:62769695-62769717 CTGGCTTTAGACCCTGATGGTGG - Intergenic
1069055787 10:63843546-63843568 GTGCCTTCGGACCATGATGCAGG - Intergenic
1070610970 10:77932289-77932311 TTGTCTTCAGACAGTGAGGCAGG + Intergenic
1072710418 10:97712853-97712875 CTGGGTTCAGACCAGGAAGCTGG - Intergenic
1072836717 10:98722788-98722810 CTGGCTTGAGACTATGATACTGG + Intronic
1073065818 10:100758669-100758691 CTGCCTGCAGGCAGTGATGCAGG + Intronic
1075446407 10:122516460-122516482 CTTGCTTTAGGCTGTGATGCAGG + Intergenic
1076079291 10:127564093-127564115 GTGGCTGCAGCCCCTGATGCAGG + Intergenic
1076406343 10:130214630-130214652 CTGCCTTCAGAGCGTGCTCCGGG + Intergenic
1077413078 11:2412499-2412521 CTGGACTCAGTCCGTGATACAGG + Intronic
1079305324 11:19316690-19316712 TTGGCTTAAGGCCGTGCTGCTGG + Intergenic
1080121275 11:28680663-28680685 GTGGCTTCAGACCGATTTGCAGG + Intergenic
1080596945 11:33781509-33781531 GTGCCTTCAGACCACGATGCAGG + Intergenic
1083856641 11:65396350-65396372 TTGGCTTCAGACGGTGACCCCGG + Intronic
1083860932 11:65419571-65419593 CTGGCTTCAGAACAAGATGTGGG + Intergenic
1084620671 11:70268431-70268453 CTGGTTTCAGACAGTGGTTCAGG + Intergenic
1085082846 11:73648245-73648267 CTGGCTTCAAACCGTTATGCCGG - Intronic
1095584506 12:43835820-43835842 CTGGAGTCAGCCCGTGGTGCGGG + Intergenic
1096075383 12:48800661-48800683 ATGGCGTCAGCCCATGATGCAGG + Intergenic
1096294914 12:50375886-50375908 CTGCCCTCAGATCGTGATACCGG + Intronic
1101812877 12:108122852-108122874 GTGCCTTCAGACTGTGATGCAGG - Intergenic
1102963946 12:117112042-117112064 CTGGCTTCTTACCTTCATGCAGG + Intergenic
1108025478 13:46172579-46172601 GTGGCTACAGACAGGGATGCAGG + Intronic
1108236813 13:48416598-48416620 CTGGCTTCAGCCCCTGTTCCAGG - Intronic
1108988546 13:56626155-56626177 CTGGCTTCATACAATGATGGAGG - Intergenic
1109033847 13:57230211-57230233 TTGGCTTCAGACTGCGGTGCTGG - Intergenic
1111510189 13:89250956-89250978 CTGTCTCCAGAACGTGTTGCTGG - Intergenic
1112255904 13:97830991-97831013 CTGGATTCAGACAGTAATGAAGG - Intergenic
1114269899 14:21094244-21094266 CTGTCTTCAGACTCTGCTGCTGG - Intronic
1116333311 14:43623090-43623112 CTGGCTTCTGACAGTAATTCAGG + Intergenic
1117850091 14:59958602-59958624 CTGGCTTCAGTCCGCTTTGCAGG + Intronic
1119072028 14:71596178-71596200 AGAGCCTCAGACCGTGATGCAGG + Intronic
1120867175 14:89305249-89305271 CTGACTTCAGACGTTTATGCTGG + Intronic
1128857540 15:71031971-71031993 CTGGCTTCAGACCGCTTTCCAGG + Intronic
1139095806 16:63703560-63703582 CTGGCTACAGCTCGTGGTGCCGG - Intergenic
1140475258 16:75236745-75236767 CTGGCTCCAGACCCTGGTTCTGG - Intronic
1142125622 16:88408954-88408976 CTGGCTTCAGAAGGTGGGGCTGG - Intergenic
1149734533 17:58980168-58980190 GTGGCATCAGCTCGTGATGCTGG + Exonic
1150637125 17:66921200-66921222 CTGGCTGCTGGCTGTGATGCTGG - Intergenic
1151534038 17:74727370-74727392 GAGCCTTCAGACCATGATGCAGG + Intronic
1159690613 18:71482986-71483008 CTGGCTTCAGCCCGTTTTCCAGG + Intergenic
1160456651 18:79006554-79006576 GTGGCTTCTCACCGTGCTGCGGG + Intergenic
1160585800 18:79912690-79912712 CTGGAATTAGACCGTGGTGCTGG + Intronic
1164590577 19:29504782-29504804 CTGACTTCAGCCCATGAGGCTGG - Intergenic
1166942201 19:46373915-46373937 CTGGCTCCAGGCCTTTATGCAGG - Intronic
926804506 2:16694023-16694045 CTGGCTTCACACTCTGGTGCTGG + Intergenic
932473407 2:71980685-71980707 CTGGCTTCATACAATGATGTAGG - Intergenic
933292593 2:80454371-80454393 CTGGGTTCAGACTGTCATGGTGG + Intronic
936904461 2:117521142-117521164 GAGGCTTCAGACCATGATACAGG + Intergenic
938041467 2:128079524-128079546 CTGCCTTCAAACCCTAATGCAGG - Intergenic
939047576 2:137267971-137267993 CTGGCTTCAAACCATGATATTGG + Intronic
939956681 2:148533273-148533295 CTGGATTAAACCCGTGATGCAGG + Intergenic
942018473 2:171841898-171841920 CTGGCTTCTGGCCCTGAAGCAGG + Intronic
946204997 2:218098687-218098709 CTGGCTTCATACAGTGATTGGGG + Intergenic
946758924 2:222973900-222973922 ATGGCTTCAAAAAGTGATGCTGG - Intergenic
948869288 2:240790188-240790210 CTGGGTTCAGACAGTGTTCCAGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1170535456 20:17336602-17336624 CTGGCTTCTGAATGTGAAGCTGG + Intronic
1171331025 20:24339052-24339074 CTGGCTCCAGACGGTGGAGCAGG - Intergenic
1172272818 20:33664016-33664038 CTGGCTCCAGACCGTGGCGATGG - Intronic
1173062574 20:39676195-39676217 AAGGCTTCAGACCATGATGCAGG + Intergenic
1173167863 20:40698715-40698737 GAGCCTTCAGACCGTGATGTTGG + Intergenic
1175866287 20:62178910-62178932 CTGGCATCAGAGCCTTATGCTGG - Intronic
1178360762 21:31947198-31947220 CTGGCTTGAGACTGGGATGTGGG - Intronic
1178360769 21:31947236-31947258 CTGGCTTGAGACTGGGATGTGGG - Intronic
1178360778 21:31947274-31947296 CTGGCTTGAGCCCGGGATGTGGG - Intronic
1178360786 21:31947312-31947334 CTGGCTTGAGACCGGGATGTGGG - Intronic
1178360793 21:31947350-31947372 CTGGCTTGAGACTGGGATGTGGG - Intronic
1179978811 21:44885833-44885855 CTGGCTTCAGACCATGGGGCAGG - Intergenic
1183947300 22:41333835-41333857 CTGGTTTCAAACTGTGATGAGGG + Intronic
953157973 3:40392251-40392273 CTGGCTTCAGCCAGAGATGGGGG - Intronic
953578946 3:44136105-44136127 AGGGCTTCAGACTGTGGTGCAGG - Intergenic
954864844 3:53719488-53719510 CTGGCAGCAGGCAGTGATGCAGG - Intronic
959091836 3:101911432-101911454 CTGGCTTCAGCCCCTGCAGCTGG + Intergenic
959609823 3:108280640-108280662 AAGCCTTCAGACTGTGATGCAGG + Intergenic
961458560 3:127036244-127036266 CTGGATTCTGAAGGTGATGCAGG - Exonic
961591996 3:127988194-127988216 CTTGCCTGAGACCGTGTTGCTGG - Intergenic
961863154 3:129934073-129934095 CTGACTTCAAATAGTGATGCTGG + Intergenic
962151011 3:132893425-132893447 GAGCCTTCAGACTGTGATGCAGG + Intergenic
971392569 4:26199752-26199774 CTGGAATCAGACAGTGATGTTGG + Intronic
973749262 4:53996968-53996990 CTGGCTTTAGACCATGATTGAGG - Intronic
974586781 4:63890090-63890112 GAGCTTTCAGACCGTGATGCTGG + Intergenic
977488314 4:97677764-97677786 CTGGCTGAAGCCCATGATGCTGG + Intronic
980841443 4:138266188-138266210 CTGGCTTCTGAGGGTGATGAAGG - Intergenic
982331942 4:154190794-154190816 CTGGCCTCAGACTTTGTTGCAGG - Intergenic
986212627 5:5688768-5688790 CTGGCTGCAGAAAGTGATGTGGG - Intergenic
990897598 5:60715788-60715810 TTGGCTTCAGACTGCTATGCTGG + Intergenic
994815955 5:104588946-104588968 CTCTCTTCACACCGTGATGTTGG - Intergenic
995008071 5:107225693-107225715 CTGACTTCAGACTATGCTGCAGG - Intergenic
996702348 5:126463110-126463132 CTGCCTTCTGACCTTGGTGCTGG + Intronic
996709049 5:126525826-126525848 CGGGATTCAGTCCGTGAGGCAGG + Intergenic
998404922 5:141868879-141868901 CTGGCTTCAGACCGTGATGCTGG - Exonic
998887030 5:146705621-146705643 CTGACTTTGGACCGTGATCCAGG - Intronic
999434730 5:151554486-151554508 GTGGCTTCAGACCTGGATGAGGG - Exonic
999935525 5:156481798-156481820 CTGGGTTCCGACCCTGATCCTGG - Intronic
1011246764 6:85327634-85327656 CTGGCATCAGCCGGTTATGCAGG - Intergenic
1013286848 6:108689408-108689430 CAGGCTTCTGACCCTGAAGCTGG - Intergenic
1013499730 6:110736489-110736511 TTGGCTTCAGATCGTAATGTGGG - Intronic
1017055588 6:150433017-150433039 CTGGCTGCAGAGCTTGACGCTGG - Intergenic
1017067390 6:150541791-150541813 CTGGCTTGAGTCCATGAAGCTGG + Intergenic
1018412912 6:163572719-163572741 CTGACCTCTGACTGTGATGCTGG - Exonic
1024825770 7:53387778-53387800 CTTCCTTCAGACGGTGATGCTGG - Intergenic
1028324118 7:89501137-89501159 CTGGATTCAGAAAGTGATCCAGG - Intergenic
1031226381 7:119042810-119042832 CTGGCCTAAGACAGTGAAGCAGG + Intergenic
1031567164 7:123314526-123314548 CTTGCTTCAGACCCTGCTGAGGG - Intergenic
1033240264 7:139673310-139673332 CAGGCTTCTGACCTTGATGGTGG + Intronic
1038993772 8:32898991-32899013 CTGGCTTCAGACCATGATCCTGG + Intergenic
1042854150 8:73248344-73248366 CTGACTTCAAACCGTGGTACAGG - Intronic
1049869409 8:144962063-144962085 CTGGCTTCATACAGTGATTTAGG + Intergenic
1053276410 9:36786872-36786894 CTGTCTTCAGACCTCCATGCAGG - Intergenic
1056950034 9:91034509-91034531 CTTGCTGCAGACCCAGATGCTGG + Intergenic
1057222916 9:93267462-93267484 CTGGTTACAGACCCTGAGGCCGG - Intronic
1057468318 9:95336518-95336540 CTGGGTGAAGACCGTGAAGCTGG - Intergenic
1059862555 9:118481187-118481209 GAGCCTTCAGACCATGATGCAGG + Intergenic
1060587159 9:124793682-124793704 CTGGCTTCAGAGCCTGCTTCTGG - Intronic
1060889510 9:127179183-127179205 CTGGCTTCAGCCCTGGAAGCAGG + Intronic
1061372922 9:130207901-130207923 CTGGCTGCAGACCCGGAAGCTGG - Intronic
1186376027 X:9002594-9002616 GTGGCTTCAGACAGTGATGCAGG + Intergenic
1186479992 X:9889470-9889492 CTGGCTTCCTACCATGAGGCTGG + Intronic
1186753866 X:12649508-12649530 CTTGCTGCAGACCGAGTTGCAGG - Intronic
1192707404 X:73541155-73541177 TTGGCTTCAGACTGCTATGCTGG - Intergenic
1195212045 X:102659854-102659876 CTGTCTTCTGACTGTCATGCAGG + Intergenic
1195374099 X:104209394-104209416 TTGCCTTTAGACTGTGATGCAGG + Intergenic
1201305046 Y:12542675-12542697 CTGTCTTCAGGCTCTGATGCAGG - Intergenic