ID: 998406265

View in Genome Browser
Species Human (GRCh38)
Location 5:141876354-141876376
Sequence CTCGCGCCGGCTCCGGCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998406265_998406277 6 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406277 5:141876383-141876405 AGCGGGCGCCAGGAGGGGGCGGG 0: 1
1: 0
2: 4
3: 61
4: 586
998406265_998406274 1 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406274 5:141876378-141876400 GGCGCAGCGGGCGCCAGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 287
998406265_998406275 2 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406275 5:141876379-141876401 GCGCAGCGGGCGCCAGGAGGGGG 0: 1
1: 0
2: 1
3: 33
4: 283
998406265_998406276 5 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406276 5:141876382-141876404 CAGCGGGCGCCAGGAGGGGGCGG 0: 1
1: 1
2: 1
3: 37
4: 433
998406265_998406280 11 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406280 5:141876388-141876410 GCGCCAGGAGGGGGCGGGGAGGG 0: 1
1: 0
2: 11
3: 109
4: 1100
998406265_998406273 0 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406273 5:141876377-141876399 CGGCGCAGCGGGCGCCAGGAGGG 0: 1
1: 1
2: 2
3: 8
4: 160
998406265_998406282 17 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406282 5:141876394-141876416 GGAGGGGGCGGGGAGGGAGCCGG 0: 1
1: 1
2: 82
3: 758
4: 5182
998406265_998406283 23 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406283 5:141876400-141876422 GGCGGGGAGGGAGCCGGCGCCGG 0: 1
1: 0
2: 8
3: 108
4: 1033
998406265_998406271 -4 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406271 5:141876373-141876395 CGAGCGGCGCAGCGGGCGCCAGG 0: 1
1: 0
2: 3
3: 22
4: 221
998406265_998406272 -1 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406272 5:141876376-141876398 GCGGCGCAGCGGGCGCCAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 262
998406265_998406279 10 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406279 5:141876387-141876409 GGCGCCAGGAGGGGGCGGGGAGG 0: 1
1: 0
2: 14
3: 174
4: 1375
998406265_998406278 7 Left 998406265 5:141876354-141876376 CCGCAAGCCGGAGCCGGCGCGAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 998406278 5:141876384-141876406 GCGGGCGCCAGGAGGGGGCGGGG 0: 1
1: 0
2: 7
3: 98
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998406265 Original CRISPR CTCGCGCCGGCTCCGGCTTG CGG (reversed) Intronic
900630583 1:3633027-3633049 CGAGCGCTGTCTCCGGCTTGAGG - Intronic
901242540 1:7704000-7704022 GTGGCGGCGGCTCCGGCTTTGGG - Intronic
901614830 1:10530433-10530455 CCTCCGCCGGCTCCGGCTAGGGG + Intronic
902755717 1:18548035-18548057 CTCCCGCTGGCTCCTGCTTCTGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
914824379 1:151131213-151131235 CTCCCGCTGGCTCCGCCTGGGGG - Intergenic
921010287 1:211134150-211134172 CTCGCGCCGGCCTCGGCTAGCGG + Intergenic
923084573 1:230693920-230693942 CTGGCGCCGGCTCCTGCCAGAGG - Exonic
1067769867 10:49115430-49115452 CTGGCGCGGGCTCCGGCTCCGGG - Exonic
1077370249 11:2178327-2178349 CTCAGGCTGGCTCAGGCTTGGGG + Intergenic
1083189291 11:61037830-61037852 ATCGGGCCAGCTCTGGCTTGAGG + Intergenic
1083899782 11:65638092-65638114 CCGGCGCCGGCTCCGCCTGGGGG - Intronic
1091718274 12:2795095-2795117 CTCGCGCCGGCACCAGCTCCCGG + Exonic
1092256373 12:6928429-6928451 CCCGCCCGGGCTCCGGCCTGCGG + Intronic
1093116771 12:15221383-15221405 CTCGCGCTCGCTCCGACTAGCGG + Exonic
1096240094 12:49955346-49955368 CCCGCGCCGGCACCGGCACGCGG - Intronic
1096777484 12:53973210-53973232 CTCCTGCCGGCTCCGGATGGAGG - Exonic
1097191160 12:57220275-57220297 CCCCCTCCGGCTCCGGCTTCGGG + Intronic
1100260493 12:92928798-92928820 CTGGCGCCCGCTCCGGCGCGGGG - Intronic
1103793159 12:123485790-123485812 CTCCCACCGGCTCCGTCTGGAGG + Exonic
1114269574 14:21092546-21092568 CCGGCTCCGGCTCCGGCTGGGGG + Exonic
1117963936 14:61188422-61188444 CTGGCTCCGGCTCCGGCTCCGGG + Intronic
1123716757 15:23039343-23039365 CACGCGCGGGCTCCGGGCTGTGG + Intronic
1132519696 16:381586-381608 CTGGCGCCGGCGCGGGGTTGGGG - Intronic
1135712623 16:24730142-24730164 CTCGCGCCGGGGCCGGATGGGGG - Intronic
1136281971 16:29218628-29218650 CTCCCGCCGGCTGTGGCTCGAGG + Intergenic
1137531733 16:49282327-49282349 CTCGCGCCCGCGCCCGCTGGGGG - Intergenic
1140020215 16:71231108-71231130 CTTGCGCCGTCTCGGGCATGGGG - Intergenic
1142086347 16:88184544-88184566 CTCCCGCCGGCTGTGGCTCGAGG + Intergenic
1145879735 17:28344455-28344477 CTGGCTGCGGCTACGGCTTGTGG - Exonic
1148490985 17:48023945-48023967 CGCCCGCCGGCTCCGGCCTGTGG + Intergenic
1155173750 18:23285782-23285804 CTCACACCGGGTCCGGCTTACGG + Intronic
1161454270 19:4362324-4362346 CTCACGCATGCTCCGGCTAGGGG + Exonic
1161979083 19:7621183-7621205 CCCGTGCCCGCTCCAGCTTGCGG + Exonic
1161991972 19:7689388-7689410 CTCGCCCTGGCTCCGGCTGGTGG + Exonic
1162459911 19:10808714-10808736 CCAGCGCCGGCTGCGGCATGGGG - Intronic
1162561323 19:11419445-11419467 CTGGCGCTGGGTCCGGCTGGAGG - Intergenic
1166389643 19:42401864-42401886 CTCGGCCCGGCTCCGGCGGGAGG + Exonic
1166748146 19:45151747-45151769 CTCATGCTGGCACCGGCTTGTGG + Exonic
1166792212 19:45405034-45405056 CCAGCTCGGGCTCCGGCTTGGGG + Intronic
930031943 2:47063763-47063785 CTCGCTCCAGCCCAGGCTTGTGG - Intronic
932591603 2:73071067-73071089 CGCGCGCCGAGCCCGGCTTGGGG + Intronic
935046908 2:99490427-99490449 CCCGCGCCTGCCCCGCCTTGGGG + Intergenic
936071360 2:109373910-109373932 CTCGGGCCTGCACCTGCTTGCGG - Intronic
1172618700 20:36306388-36306410 CCCGCCCCGGCTCCGGCCCGCGG - Exonic
1175779626 20:61674206-61674228 CTCGGGGCAGCTCAGGCTTGGGG - Intronic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1179547818 21:42124351-42124373 CCCGTGCCGGCTCTGGGTTGGGG + Intronic
1179985380 21:44918056-44918078 CTGGCACCAGGTCCGGCTTGGGG + Intronic
1182903984 22:33920847-33920869 CGCGCGCCGGCTCCGGCCAGCGG - Intronic
1184155091 22:42662222-42662244 CTCCCACCGGCTTCGGCTGGGGG + Intergenic
1184229679 22:43151814-43151836 CGCGGGCCGCCTCCGGCTGGGGG + Intronic
952335727 3:32401659-32401681 CTCGCGCCGGGCCCAGCGTGCGG + Intronic
961664829 3:128488643-128488665 CTGGCGCCGGCGCCAGCTGGAGG + Intronic
963870335 3:150408844-150408866 CTGACGCCGGCACCGGCCTGAGG + Exonic
980130420 4:128811756-128811778 CCCGCGCCGGTTCCGGCGGGCGG + Intronic
998406265 5:141876354-141876376 CTCGCGCCGGCTCCGGCTTGCGG - Intronic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1013099529 6:106974990-106975012 CCCGCGCCGGCTGCGGGCTGCGG + Intronic
1023788183 7:43729271-43729293 TTCGCGCCGGCGCCGGGTCGCGG - Intronic
1036928701 8:12931699-12931721 CCGGAGCCGGCTCCTGCTTGCGG - Intergenic
1044719823 8:95134218-95134240 CTCGCGCCGGGGCCGGCCCGCGG + Intronic
1053312054 9:37026479-37026501 CTCCCGCCGGGACCGGGTTGGGG - Intronic
1053642945 9:40105878-40105900 TTCCCGGCGGTTCCGGCTTGGGG - Intergenic
1053763206 9:41359612-41359634 TTCCCGGCGGTTCCGGCTTGGGG + Intergenic
1054541815 9:66270779-66270801 TTCCCGGCGGTTCCGGCTTGGGG + Intergenic
1059653373 9:116335208-116335230 CTCTGGCCGGCTCTGCCTTGTGG + Intronic
1060599601 9:124869207-124869229 CTCGCACCGGCTCCTGCTCGGGG - Exonic
1061421731 9:130476489-130476511 CTCTCGCCGGCTCGGGATTGGGG - Intronic
1061975749 9:134067467-134067489 CGCGCGGCGGCCCCGGCCTGCGG - Intronic
1062095551 9:134701417-134701439 CTCGGGCCGGGACCGGCTGGCGG + Intronic
1062362289 9:136193689-136193711 CCCGCGCCCGCTCCAGCTGGCGG - Intergenic
1062491702 9:136808076-136808098 GCCGCGCCGGCTCCGGCCTCCGG + Exonic