ID: 998407701

View in Genome Browser
Species Human (GRCh38)
Location 5:141883273-141883295
Sequence AAGGCCCCATTCATCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998407691_998407701 8 Left 998407691 5:141883242-141883264 CCGCCGCTGACCCCGTGGCATGC No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407686_998407701 24 Left 998407686 5:141883226-141883248 CCCGGGGACCCGGTGGCCGCCGC No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407684_998407701 26 Left 998407684 5:141883224-141883246 CCCCCGGGGACCCGGTGGCCGCC No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407688_998407701 16 Left 998407688 5:141883234-141883256 CCCGGTGGCCGCCGCTGACCCCG No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407695_998407701 -3 Left 998407695 5:141883253-141883275 CCCGTGGCATGCGGCTCTCAAAG No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407685_998407701 25 Left 998407685 5:141883225-141883247 CCCCGGGGACCCGGTGGCCGCCG No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407689_998407701 15 Left 998407689 5:141883235-141883257 CCGGTGGCCGCCGCTGACCCCGT No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407687_998407701 23 Left 998407687 5:141883227-141883249 CCGGGGACCCGGTGGCCGCCGCT No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407696_998407701 -4 Left 998407696 5:141883254-141883276 CCGTGGCATGCGGCTCTCAAAGG No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407694_998407701 -2 Left 998407694 5:141883252-141883274 CCCCGTGGCATGCGGCTCTCAAA No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data
998407693_998407701 5 Left 998407693 5:141883245-141883267 CCGCTGACCCCGTGGCATGCGGC No data
Right 998407701 5:141883273-141883295 AAGGCCCCATTCATCTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998407701 Original CRISPR AAGGCCCCATTCATCTCTGG GGG Intergenic
No off target data available for this crispr