ID: 998407739

View in Genome Browser
Species Human (GRCh38)
Location 5:141883409-141883431
Sequence GGGTCCCGATGGAGATCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998407739_998407744 5 Left 998407739 5:141883409-141883431 CCACCAGATCTCCATCGGGACCC No data
Right 998407744 5:141883437-141883459 CGACCCCGAGCCCTTTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998407739 Original CRISPR GGGTCCCGATGGAGATCTGG TGG (reversed) Intergenic