ID: 998410200

View in Genome Browser
Species Human (GRCh38)
Location 5:141904212-141904234
Sequence GGGAAGAGTAGACCAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998410196_998410200 8 Left 998410196 5:141904181-141904203 CCTGAAGGATGAGAAGTCTGGAA No data
Right 998410200 5:141904212-141904234 GGGAAGAGTAGACCAGAAGGAGG No data
998410195_998410200 9 Left 998410195 5:141904180-141904202 CCCTGAAGGATGAGAAGTCTGGA No data
Right 998410200 5:141904212-141904234 GGGAAGAGTAGACCAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998410200 Original CRISPR GGGAAGAGTAGACCAGAAGG AGG Intergenic
No off target data available for this crispr