ID: 998411448

View in Genome Browser
Species Human (GRCh38)
Location 5:141914449-141914471
Sequence GGCTCAACTGCCTGCGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998411448_998411457 5 Left 998411448 5:141914449-141914471 CCGTCTCCGCAGGCAGTTGAGCC No data
Right 998411457 5:141914477-141914499 CTGGGGCGCTCCTCTGGTCAGGG No data
998411448_998411454 -1 Left 998411448 5:141914449-141914471 CCGTCTCCGCAGGCAGTTGAGCC No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data
998411448_998411456 4 Left 998411448 5:141914449-141914471 CCGTCTCCGCAGGCAGTTGAGCC No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998411448 Original CRISPR GGCTCAACTGCCTGCGGAGA CGG (reversed) Intergenic
No off target data available for this crispr