ID: 998411454

View in Genome Browser
Species Human (GRCh38)
Location 5:141914471-141914493
Sequence CTGCCGCTGGGGCGCTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998411446_998411454 15 Left 998411446 5:141914433-141914455 CCGGGCGATTCTGGGGCCGTCTC No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data
998411448_998411454 -1 Left 998411448 5:141914449-141914471 CCGTCTCCGCAGGCAGTTGAGCC No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data
998411442_998411454 22 Left 998411442 5:141914426-141914448 CCTGACCCCGGGCGATTCTGGGG No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data
998411445_998411454 16 Left 998411445 5:141914432-141914454 CCCGGGCGATTCTGGGGCCGTCT No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data
998411444_998411454 17 Left 998411444 5:141914431-141914453 CCCCGGGCGATTCTGGGGCCGTC No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data
998411449_998411454 -7 Left 998411449 5:141914455-141914477 CCGCAGGCAGTTGAGCCTGCCGC No data
Right 998411454 5:141914471-141914493 CTGCCGCTGGGGCGCTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998411454 Original CRISPR CTGCCGCTGGGGCGCTCCTC TGG Intergenic
No off target data available for this crispr