ID: 998411456

View in Genome Browser
Species Human (GRCh38)
Location 5:141914476-141914498
Sequence GCTGGGGCGCTCCTCTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998411445_998411456 21 Left 998411445 5:141914432-141914454 CCCGGGCGATTCTGGGGCCGTCT No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data
998411448_998411456 4 Left 998411448 5:141914449-141914471 CCGTCTCCGCAGGCAGTTGAGCC No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data
998411442_998411456 27 Left 998411442 5:141914426-141914448 CCTGACCCCGGGCGATTCTGGGG No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data
998411446_998411456 20 Left 998411446 5:141914433-141914455 CCGGGCGATTCTGGGGCCGTCTC No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data
998411449_998411456 -2 Left 998411449 5:141914455-141914477 CCGCAGGCAGTTGAGCCTGCCGC No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data
998411444_998411456 22 Left 998411444 5:141914431-141914453 CCCCGGGCGATTCTGGGGCCGTC No data
Right 998411456 5:141914476-141914498 GCTGGGGCGCTCCTCTGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998411456 Original CRISPR GCTGGGGCGCTCCTCTGGTC AGG Intergenic
No off target data available for this crispr