ID: 998411490

View in Genome Browser
Species Human (GRCh38)
Location 5:141914613-141914635
Sequence CTGCCCCTTTAGGCCCCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998411490_998411494 -2 Left 998411490 5:141914613-141914635 CCACGCGGGGCCTAAAGGGGCAG No data
Right 998411494 5:141914634-141914656 AGGCGTTGGATCCTGATACCTGG No data
998411490_998411495 -1 Left 998411490 5:141914613-141914635 CCACGCGGGGCCTAAAGGGGCAG No data
Right 998411495 5:141914635-141914657 GGCGTTGGATCCTGATACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998411490 Original CRISPR CTGCCCCTTTAGGCCCCGCG TGG (reversed) Intergenic
No off target data available for this crispr