ID: 998417805

View in Genome Browser
Species Human (GRCh38)
Location 5:141958279-141958301
Sequence GGAAATGCTCTTTCTCTAAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 199}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998417805_998417808 5 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417808 5:141958307-141958329 AGCTAAGTGGCCTGCCGCTGAGG 0: 1
1: 0
2: 0
3: 7
4: 130
998417805_998417816 26 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417816 5:141958328-141958350 GGAGGATGAGGCCGGGGCTCCGG 0: 1
1: 0
2: 4
3: 83
4: 792
998417805_998417817 27 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417817 5:141958329-141958351 GAGGATGAGGCCGGGGCTCCGGG 0: 1
1: 0
2: 1
3: 54
4: 520
998417805_998417809 8 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 63
998417805_998417815 20 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417815 5:141958322-141958344 CGCTGAGGAGGATGAGGCCGGGG 0: 1
1: 0
2: 2
3: 55
4: 837
998417805_998417818 28 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417818 5:141958330-141958352 AGGATGAGGCCGGGGCTCCGGGG 0: 1
1: 0
2: 1
3: 30
4: 261
998417805_998417806 -8 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417806 5:141958294-141958316 GCATTTCCTGTGAAGCTAAGTGG 0: 1
1: 0
2: 1
3: 16
4: 151
998417805_998417812 18 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417812 5:141958320-141958342 GCCGCTGAGGAGGATGAGGCCGG 0: 1
1: 0
2: 130
3: 6521
4: 110970
998417805_998417810 14 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417810 5:141958316-141958338 GCCTGCCGCTGAGGAGGATGAGG 0: 1
1: 1
2: 1
3: 26
4: 677
998417805_998417814 19 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417814 5:141958321-141958343 CCGCTGAGGAGGATGAGGCCGGG 0: 1
1: 1
2: 0
3: 59
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998417805 Original CRISPR GGAAATGCTCTTTCTCTAAT TGG (reversed) Exonic
905661861 1:39733629-39733651 CAAAATGCTCTTTCTCTGGTTGG + Intronic
907772361 1:57478307-57478329 GGAAATGATCTTCCACAAATAGG + Intronic
908586974 1:65580597-65580619 GGAAATTCTCTTTCTTTATTAGG + Intronic
908701809 1:66910481-66910503 TGAAATGCTCTTTCTCATACAGG + Intronic
910759858 1:90723457-90723479 TGAATTTCTCTTTCTCTGATTGG - Intergenic
912241202 1:107911165-107911187 GGAAATACTCTTTTCGTAATAGG - Intronic
913016812 1:114745398-114745420 GAAAATGCTTATTCTGTAATAGG + Intronic
916661490 1:166926016-166926038 GGAAATGGTCTTTTTATAGTCGG + Intronic
916837243 1:168559130-168559152 GGTAAGGCTCTCTATCTAATTGG - Intergenic
918678377 1:187319617-187319639 GGAAATGCTGTTTCTCCACAGGG - Intergenic
919847355 1:201650280-201650302 GGAACTGCTCTTTCTCTCCCCGG + Intronic
920386890 1:205575848-205575870 AGTGAGGCTCTTTCTCTAATTGG + Intronic
920850749 1:209626598-209626620 GGAAATGCTCTCTCTCTCTCAGG + Intronic
920907159 1:210182097-210182119 GGATATGGCTTTTCTCTAATAGG - Intergenic
922338793 1:224639077-224639099 GCAAATTCTCTTTCCCCAATAGG + Intronic
924671539 1:246131808-246131830 GAAAATGTTCTGTCTTTAATTGG - Intronic
1064762964 10:18640645-18640667 GGAAATGCTCTATCTTGACTGGG + Intronic
1065416450 10:25492481-25492503 AGAACAGCTCTTTCACTAATTGG - Intronic
1065508899 10:26457700-26457722 GGAAATGCTCTCTATGCAATGGG + Intronic
1067272275 10:44802753-44802775 GGAACTGGACTTTCTCTTATGGG - Intergenic
1067807046 10:49399631-49399653 GTAAATCTGCTTTCTCTAATGGG + Intergenic
1069251420 10:66271788-66271810 GGAAGTGCTCTTTCACCAAAGGG - Intronic
1070131168 10:73656298-73656320 GGAACTGTGCCTTCTCTAATAGG + Intronic
1071673070 10:87629432-87629454 AGAAATTGTTTTTCTCTAATGGG + Intergenic
1075539939 10:123303880-123303902 GAAAATGCTCTTAAACTAATGGG - Intergenic
1075579696 10:123607797-123607819 AGAAAGGCTCTTTCTATAAAGGG + Intergenic
1077875073 11:6297678-6297700 GGTAATGCTCATTCTCAATTTGG - Intergenic
1078450828 11:11439447-11439469 GGAATTGGTCTTTCTCTACTGGG - Intronic
1080292547 11:30687488-30687510 GGATATGCTCTTCCTCTACTTGG + Intergenic
1080309174 11:30869547-30869569 GGACATGCCCTTTCTCTCACTGG - Intronic
1081295880 11:41388711-41388733 GTTAATGTTCTTTCTATAATTGG - Intronic
1081903598 11:46651339-46651361 TCAAATTCTCTTTCCCTAATAGG - Intronic
1082588602 11:54975852-54975874 GGATATTCTCTTTCTCACATTGG - Intergenic
1085641823 11:78197566-78197588 GGAAATGGTCTTTCTCATCTAGG + Intronic
1086158842 11:83698232-83698254 GGAAATGTTCTTTCCAAAATTGG + Intronic
1086902626 11:92384898-92384920 GGAGCTGCTGTTTTTCTAATAGG + Intronic
1088465706 11:110135584-110135606 GGAAATGTTATTTCTCTACTAGG - Intronic
1092682019 12:10993898-10993920 GGGAATGGTCTTGCACTAATTGG - Intronic
1093024037 12:14230414-14230436 GAATCTGCTGTTTCTCTAATGGG + Intergenic
1093437241 12:19149722-19149744 GGAATGACTCTTCCTCTAATAGG + Intronic
1093791911 12:23261657-23261679 GGAAAACATCTTTCTCTAATTGG - Intergenic
1095820860 12:46477187-46477209 GGAGAATCTCTTACTCTAATTGG - Intergenic
1096055759 12:48650521-48650543 TGAAATGTTCTTTCTCTTACAGG - Intergenic
1097610204 12:61810261-61810283 AGTTATACTCTTTCTCTAATGGG + Intronic
1099010221 12:77282948-77282970 GGAAAATCTCTTTCTGTAAAGGG + Intergenic
1099056393 12:77846735-77846757 GGAAATGTCCTTTCTTTAACAGG + Intronic
1099742435 12:86657351-86657373 AGAAATGCTCTTTCTTCAGTAGG + Intronic
1099864601 12:88263946-88263968 GAAAATGCTTTTTCTCTAGCTGG - Intergenic
1100658010 12:96667638-96667660 GGAAATCCTTTTTCTCTGGTAGG + Intronic
1100956662 12:99916390-99916412 CCAAATGCTCTTACTCTAACTGG - Intronic
1101185865 12:102277943-102277965 GGAAATGCTGTTACTGGAATTGG + Intergenic
1102033283 12:109756584-109756606 GCAAATGCTCTGTGTCTATTGGG + Intronic
1103537314 12:121641812-121641834 GGAAATGCTTATTCTCTTAGAGG - Exonic
1103837350 12:123833312-123833334 GAAAAAACGCTTTCTCTAATAGG + Exonic
1104339865 12:127938200-127938222 GCAAATTCTCTTTCTTTACTAGG - Intergenic
1105845195 13:24287961-24287983 AGAACTGCCCGTTCTCTAATCGG + Intronic
1106490787 13:30219691-30219713 GGAAATGCTTTTTCCCCAAGGGG - Intronic
1106609494 13:31264878-31264900 GGAAATACTTTTGCTGTAATTGG + Intronic
1108431626 13:50359530-50359552 GGAGATGCTGTTTCTTTACTGGG - Intronic
1109038248 13:57294725-57294747 GGAAATACTCCTTCTGTCATGGG - Intergenic
1109762741 13:66851226-66851248 GGAGATTATTTTTCTCTAATAGG - Intronic
1111325404 13:86688320-86688342 GGAAATGATATTTTTCTAAAAGG + Intergenic
1112164853 13:96907303-96907325 GGCAATGCTCCTTCTATATTGGG + Intergenic
1114365222 14:22019297-22019319 GGCAATGCTGTTTCTCAATTTGG + Intergenic
1115439554 14:33416903-33416925 AGAAATCCTGTTTCTGTAATTGG - Intronic
1117870385 14:60194527-60194549 GGCAATGCTCTTTCTTGATTAGG + Intergenic
1118824521 14:69368165-69368187 GGAAAAGCTCTTTCCCTTGTGGG + Intergenic
1119134265 14:72202682-72202704 GGAAAGGCTGTTTCTCTACAAGG + Intronic
1119552317 14:75523964-75523986 GGAAGTGCTCTTCCTCTAAGGGG - Intronic
1121221343 14:92288057-92288079 GGAAATGTTCTTTCTACCATGGG - Intergenic
1125043416 15:35218580-35218602 AGAAATTATCTTTTTCTAATAGG + Intronic
1125190042 15:36981143-36981165 GGGAATGCTCATTTTCTATTTGG - Intronic
1125625897 15:41109017-41109039 GGCAATGCTTTTTTTCTTATTGG - Intronic
1127108643 15:55644642-55644664 GGAACTGCTCTTCCTTTCATGGG - Intronic
1127357472 15:58214296-58214318 TGATATGCTTTTTCTCTAAAAGG + Intronic
1127495315 15:59505785-59505807 GTAAATGCTCTTTGTCTCGTAGG - Intronic
1131540868 15:93274256-93274278 GGAAATGCTCCTTCGGTAAGAGG - Intergenic
1132312143 15:100864954-100864976 TGTAATGCTCTTTGTCTAATTGG + Intergenic
1133804377 16:9113342-9113364 GGAAATCATCTTTTTCTACTGGG - Intronic
1140251583 16:73299270-73299292 GAAAATGCTTTTTCTCTTCTAGG - Intergenic
1140327469 16:74018800-74018822 GGAAGTGTTATTTCTCTAGTGGG + Intergenic
1140596069 16:76414264-76414286 TGAAATGCTTTTTCTGTATTTGG + Intronic
1140779838 16:78284977-78284999 GGAACTGATCTTTCTGAAATAGG + Intronic
1141022495 16:80510660-80510682 GGAAGTGCTCATTGTCTAGTGGG - Intergenic
1143103570 17:4517146-4517168 GGAAATGCCCATTCTCGAAAGGG - Intronic
1144026533 17:11281293-11281315 GGAGATGCCCTTTATCAAATAGG + Intronic
1145046208 17:19618833-19618855 GGAAATGGTTCTTCTCTAAATGG - Intergenic
1145215165 17:21045684-21045706 TGAAGTGCTTTTTTTCTAATGGG + Intergenic
1145873774 17:28299877-28299899 GGAAATGCTCTCACTCCACTTGG - Intergenic
1148517400 17:48233144-48233166 AGAAATGCTCCATCTCCAATAGG + Intronic
1149118013 17:53122439-53122461 GGAAATGCTCTATGTTTAAAAGG - Intergenic
1150220233 17:63491923-63491945 GGAAATGGCCTTTCTCTACAGGG + Intronic
1152319428 17:79599879-79599901 GGAAATGCTCTTTATTTCCTGGG - Intergenic
1156296602 18:35797452-35797474 GGAAATGCTCTTTTTCCAACTGG + Intergenic
1156945297 18:42822213-42822235 TGAACTGCTTATTCTCTAATTGG - Intronic
1158078323 18:53558621-53558643 GGAAATGTTTATTCTCAAATTGG + Intergenic
1159348355 18:67236769-67236791 AGAAATGGTCTTAATCTAATAGG + Intergenic
1163106337 19:15125069-15125091 GGAAGTGCCCTTTCTCTCTTAGG - Exonic
1165056594 19:33180908-33180930 GGAAATGCTCTTTATTTTGTAGG + Intronic
1167966414 19:53151096-53151118 GGAACAGATCTTTCTCTCATGGG - Intronic
1167972128 19:53194698-53194720 GGAAAAGATCTTTTTCTCATGGG - Intergenic
925870784 2:8268496-8268518 CGAAATGCTCTTTCTGTAAGTGG - Intergenic
927536012 2:23859540-23859562 GTGAATGCTCTGTCTGTAATAGG + Intronic
929124291 2:38509156-38509178 AGAAATGGCCTTTCTCTAAGGGG - Intergenic
929996896 2:46833116-46833138 GGAAATGTTCTATCTAAAATTGG - Intronic
930247174 2:48996045-48996067 GGAAATGCGCTTTGGCTAAAAGG - Intronic
931848718 2:66231583-66231605 AGAAAAGCTCTATCTCTAAAGGG - Intergenic
934064948 2:88331793-88331815 GGAAGTTCTCTCTCTCTGATTGG + Intergenic
935925364 2:108063108-108063130 GAAGATGCTCTTTATCTGATTGG - Intergenic
936894249 2:117408659-117408681 GGAAATGATCTTTGTGTAATGGG - Intergenic
937604710 2:123784823-123784845 GGAAATGCTTATTCACTGATGGG - Intergenic
937703546 2:124891813-124891835 GGAAATGTACTGTTTCTAATTGG - Intronic
937960593 2:127455033-127455055 GGAAATGCTCATGCTTTAAAGGG + Intronic
939473720 2:142658464-142658486 AGATATGATCTTTCTCTCATAGG - Intergenic
940640514 2:156341483-156341505 TGTAATGCACTTTCGCTAATTGG - Intronic
942182011 2:173389119-173389141 GGAAATAGACTTTCTGTAATAGG - Intergenic
942635525 2:178000057-178000079 GGAAATGCTCTTTTGTTGATTGG + Intronic
944131860 2:196355534-196355556 GTAAATGCTCTTTTTCCATTTGG + Intronic
945144551 2:206723733-206723755 GTAAATCCTCTTTCTCTCTTGGG - Intergenic
947236245 2:227944165-227944187 GAAAATGCTCTCACTCTACTTGG - Intergenic
1170015811 20:11780616-11780638 GGAACTGCTTTTTCATTAATAGG - Intergenic
1173340050 20:42145036-42145058 TGGAATGCTTTTTCTGTAATGGG + Intronic
1173966815 20:47118718-47118740 GGAAATGGTCTCTCTCAAAGCGG - Intronic
1174632266 20:51968137-51968159 TGAAATGCTTTTTCTTTAAAGGG + Intergenic
1177158564 21:17523339-17523361 TCAAATGCTCTTTCTCTTCTAGG - Intronic
1177961130 21:27667712-27667734 GGATATGTTCATACTCTAATAGG - Intergenic
1181688083 22:24543014-24543036 GGACATCCTCTTTGTCTACTTGG - Exonic
1184615988 22:45639205-45639227 GGAAATGCTGACTCACTAATAGG - Intergenic
950924302 3:16724979-16725001 AGAAAAGCTCTTTCTTTACTTGG - Intergenic
958649998 3:96926597-96926619 ATAAATGCTCTTACTCTAAATGG + Intronic
959135650 3:102416336-102416358 TGAAATGCTCATTTTCTTATAGG + Intronic
963647838 3:147939543-147939565 GAAAATTTTCTTTCTCTGATTGG - Intergenic
963749750 3:149164339-149164361 GGCACTGCTATTTCTCTTATAGG + Intronic
967657221 3:192064691-192064713 GGGAAGGCTCTGTTTCTAATTGG + Intergenic
967710154 3:192697397-192697419 AGAAATGCACATTCTCTAAGGGG + Intronic
968268542 3:197381550-197381572 TGAAATGCTCTTTCTACAGTTGG + Intergenic
969067535 4:4499456-4499478 TGAAATGCTGTTTTTCTAAAAGG - Intronic
970514212 4:16811510-16811532 GTAAATGCCCTTTCCCTAAAAGG - Intronic
970566649 4:17338196-17338218 GGAAATGGTCTTTCTTTGGTGGG + Intergenic
971760708 4:30761037-30761059 GGAACTGCTCTCTGTTTAATAGG + Intronic
972698439 4:41470441-41470463 GGGACTTCTCTTTCTCTACTGGG + Intronic
973537396 4:51897054-51897076 GGAAAGGCTCTCTGTCTATTAGG - Intronic
977410954 4:96663277-96663299 TGCAATGCTATTTCTATAATTGG + Intergenic
977872153 4:102104991-102105013 GTAGATGCTCTTTATCAAATTGG - Intergenic
978083184 4:104619663-104619685 AGAAATGTTCTCTCTATAATTGG - Intergenic
980905972 4:138949257-138949279 GGAATTACTATTTCTCTAAGGGG - Intergenic
981695435 4:147554502-147554524 GGAAATGTATTTTCTCTGATTGG - Intergenic
981922590 4:150101415-150101437 GGGAATTCTCTTTCACTATTTGG + Intronic
982411244 4:155080012-155080034 GGAAGAGCTCTTTTTCTACTGGG - Intergenic
984975633 4:185227934-185227956 CTAAATGCTCTTTCTCTCCTTGG - Intronic
985859899 5:2462491-2462513 GGACATGCTCTTTCTCTCCCTGG + Intergenic
985962490 5:3313026-3313048 GCAGTTGCTCTTTCTCTAACTGG - Intergenic
986546330 5:8901883-8901905 GCAAAGGCTTTTTCTCTAATTGG - Intergenic
988266972 5:28964292-28964314 AAAAATGCTCTTTCTGTAATGGG + Intergenic
988329151 5:29812616-29812638 GGAAATTATCTTTCTATAACAGG - Intergenic
989303248 5:39919315-39919337 GGAAATGTTCTTTTTGTATTGGG + Intergenic
990226027 5:53655241-53655263 GGAAATGCTGTTTCTCCATCTGG - Intronic
990473194 5:56136937-56136959 GGAGATGCTCTTTCCCTAAGTGG + Intronic
992942214 5:81773610-81773632 GGGAATGCTCTTTCTAAAATTGG - Intergenic
993180132 5:84542075-84542097 GGGAAGGCTCTTACTCTATTAGG - Intergenic
995280748 5:110332880-110332902 GGACAAGCTTTTTCTCTAATGGG - Intronic
995385643 5:111586022-111586044 GCAAATTCACTGTCTCTAATTGG + Intergenic
996215842 5:120864363-120864385 GGAAATGTACTTTCTTTAAAAGG + Intergenic
997286561 5:132683400-132683422 GTAAATTCTCTTTCTTCAATAGG + Intergenic
998417805 5:141958279-141958301 GGAAATGCTCTTTCTCTAATTGG - Exonic
999922006 5:156331516-156331538 GGAATTGTGCTTGCTCTAATAGG - Intronic
1003793741 6:9576833-9576855 GGAAAGGCTCTTACTCTAAGAGG - Intergenic
1008697557 6:54058188-54058210 GGAAATGCTGTGTTTATAATTGG + Intronic
1009435901 6:63618317-63618339 GTAAGTTCTCTTTCTCAAATTGG + Intergenic
1009680034 6:66880617-66880639 GTACATGCTCCTTCTCTAAAAGG + Intergenic
1010757711 6:79685882-79685904 GGAAAAGTTATTTCTCTAATAGG - Intronic
1010823048 6:80438672-80438694 GAAAATGTTACTTCTCTAATTGG - Intergenic
1011163907 6:84424394-84424416 TGAAATTCTCTTTCTATATTTGG + Intergenic
1014811969 6:125896867-125896889 TAAAGTGCTGTTTCTCTAATTGG + Intronic
1015602961 6:134928379-134928401 GTAAATGCTCTGTCTCTCATTGG + Intronic
1016989688 6:149920611-149920633 GGAGATGCTCTTCCTGAAATGGG + Intronic
1016996998 6:149967789-149967811 GGAAATGCTGTTCCTGAAATGGG - Intronic
1017011527 6:150066886-150066908 GGAGATGCTCTTCCTGAAATGGG + Intronic
1017293412 6:152767409-152767431 GGAAATGTTTTCTCTCTAATAGG - Intergenic
1017350809 6:153439726-153439748 GGAAATTCTCTGTTTCTGATGGG - Intergenic
1020958576 7:14774170-14774192 GGCATTGTTGTTTCTCTAATGGG + Intronic
1021322081 7:19224960-19224982 CAAAATGTTATTTCTCTAATAGG + Intergenic
1022255368 7:28651327-28651349 GGAAATGCTTTCTCTCCATTTGG - Intronic
1022804747 7:33810284-33810306 GGCAAGGCTCTCTCTCAAATGGG + Intergenic
1024438914 7:49392023-49392045 GGACATCCTCTTTCTCTGACAGG + Intergenic
1025089811 7:56052343-56052365 GGAAAAGCCCGTTTTCTAATGGG + Intronic
1025851551 7:65248739-65248761 GCAAAAGCTCTTTCTTTCATTGG - Intergenic
1025901963 7:65751634-65751656 GGAAAAGCCCGTTTTCTAATGGG + Intergenic
1025902024 7:65752071-65752093 GGAAAAGCCCATTTTCTAATGGG + Intergenic
1026394303 7:69936076-69936098 GGAAATTCTTGTCCTCTAATGGG + Intronic
1028969727 7:96845363-96845385 TAAATTTCTCTTTCTCTAATTGG - Intergenic
1030072687 7:105711487-105711509 GTAAATGTTCTTGCTCTAAATGG + Intronic
1030397683 7:109008163-109008185 GGAAATAATCTTTCATTAATAGG + Intergenic
1036029360 8:4949970-4949992 GCAAATGTTTTTTATCTAATTGG + Intronic
1036665715 8:10735984-10736006 AGAAATGATCTTTATTTAATGGG + Intronic
1037680156 8:21090361-21090383 GGAAATCCTCTTACCCTCATGGG - Intergenic
1039783043 8:40806167-40806189 GCAAATGCTGTTTCTCAAACTGG - Intronic
1042004155 8:64162365-64162387 GGAGATCCTCTTTCTCTTGTGGG - Intergenic
1044398732 8:91744660-91744682 GGAAATACTCTTGATCTATTTGG - Intergenic
1044449607 8:92319161-92319183 GGTCATGCTCTTGCTGTAATGGG + Intergenic
1044754160 8:95444553-95444575 GGAAATGCTCTTAATGTACTTGG - Intergenic
1044832670 8:96265525-96265547 GGAAATGAGCTTTTTCAAATAGG - Intronic
1044915630 8:97110073-97110095 GGAAATGTTCTGTCTTTATTTGG - Intronic
1048861210 8:138725439-138725461 CCAAATGCTCTTTCTCTACAGGG - Exonic
1049077154 8:140407554-140407576 GGAGATGCCCTTTCTTTAAAAGG - Intronic
1050412297 9:5379619-5379641 TGAAATGCCCTTTTTCTATTGGG - Intronic
1053161178 9:35814584-35814606 GGAAATGAGCTTTCTCTTCTTGG - Intronic
1057096533 9:92315731-92315753 AGAAATGCTGTTTCTCTTCTTGG + Exonic
1057140213 9:92722222-92722244 GGAACCCCTCTGTCTCTAATGGG - Intronic
1057693219 9:97305526-97305548 GGTAATGCTCTGTTTCTTATGGG + Intergenic
1058836963 9:108865770-108865792 GGAGATTCTCTTTTTCTACTGGG - Intergenic
1060474995 9:123980058-123980080 GAAAAAGCTCTTTCTCTTTTAGG - Intergenic
1186632274 X:11362705-11362727 GGAAATACTTTTTTTCAAATGGG - Intronic
1186682432 X:11890029-11890051 GGAAGGGCTCTTTCTCTTGTTGG + Intergenic
1189686137 X:43565305-43565327 GGAAATGCTGTTTCCCTAGCTGG - Intergenic
1190832300 X:54070100-54070122 GGAGATGAACTTTTTCTAATTGG - Exonic
1192867415 X:75149831-75149853 TGAAATGCCCTCTCTCTAACTGG - Intronic
1193249501 X:79272117-79272139 GGAAATGGCATTTATCTAATAGG - Intergenic
1198442926 X:136681968-136681990 GAGAATGTTCTTTTTCTAATAGG - Exonic