ID: 998417809 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:141958310-141958332 |
| Sequence | TAAGTGGCCTGCCGCTGAGG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 66 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 63} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998417805_998417809 | 8 | Left | 998417805 | 5:141958279-141958301 | CCAATTAGAGAAAGAGCATTTCC | 0: 1 1: 0 2: 0 3: 19 4: 199 |
||
| Right | 998417809 | 5:141958310-141958332 | TAAGTGGCCTGCCGCTGAGGAGG | 0: 1 1: 0 2: 0 3: 2 4: 63 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998417809 | Original CRISPR | TAAGTGGCCTGCCGCTGAGG AGG | Exonic | ||