ID: 998417809

View in Genome Browser
Species Human (GRCh38)
Location 5:141958310-141958332
Sequence TAAGTGGCCTGCCGCTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998417805_998417809 8 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998417809 Original CRISPR TAAGTGGCCTGCCGCTGAGG AGG Exonic