ID: 998417809

View in Genome Browser
Species Human (GRCh38)
Location 5:141958310-141958332
Sequence TAAGTGGCCTGCCGCTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998417805_998417809 8 Left 998417805 5:141958279-141958301 CCAATTAGAGAAAGAGCATTTCC 0: 1
1: 0
2: 0
3: 19
4: 199
Right 998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998417809 Original CRISPR TAAGTGGCCTGCCGCTGAGG AGG Exonic
900630511 1:3632702-3632724 TAAGGGTACTGACGCTGAGGTGG - Intronic
908271426 1:62426397-62426419 TAAGTGGGCGGGTGCTGAGGGGG - Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
918103912 1:181400376-181400398 TATGTGGCCTGACGTTGGGGTGG + Intergenic
919752796 1:201048699-201048721 GCAGTGGCCTGCCGCTGAGCTGG + Intronic
1065421963 10:25554944-25554966 TCAGTGGCTTGCCAGTGAGGTGG - Intronic
1074807563 10:117068505-117068527 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1074807636 10:117069381-117069403 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1076639588 10:131905117-131905139 TAAGTGTCCTGCTGATGAGCAGG + Intronic
1077423724 11:2464775-2464797 TAGGTGGGCTGGGGCTGAGGCGG + Intronic
1079533658 11:21485405-21485427 TTGGAGGCCTGCCACTGAGGAGG - Intronic
1085040335 11:73323123-73323145 GAAGTGCCCTGCCTCTCAGGGGG + Intronic
1088809206 11:113378755-113378777 TTAGTGGCCTGACCCTGGGGAGG + Intronic
1091720884 12:2812672-2812694 TAGGTGGCCTTCCGCTCTGGCGG + Exonic
1097972575 12:65650255-65650277 GAAGTGGCCTGCCACTCAAGAGG - Intergenic
1098697490 12:73578362-73578384 TGAGTGGCCTGGAGCTGAGTTGG + Intergenic
1104258437 12:127160826-127160848 TAATTGGCCTGCCCCGAAGGGGG - Intergenic
1109143910 13:58752247-58752269 TAAGTGGGCTGAGGCTGATGTGG + Intergenic
1113816023 13:113171796-113171818 TGCGTGCCCAGCCGCTGAGGAGG - Exonic
1118388612 14:65277850-65277872 TAAGGGGCCCGCCTCTGGGGAGG - Intergenic
1123084988 14:105713203-105713225 TGAGTGGACTCCCGTTGAGGGGG + Intergenic
1124631013 15:31337175-31337197 TAAGTGGCCTGCGGCAGGGCAGG + Intronic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1138233354 16:55357739-55357761 AAAGTGGGCAGTCGCTGAGGAGG - Intergenic
1140782903 16:78312842-78312864 TAAGTGGTCAGCCTCCGAGGTGG + Intronic
1147164138 17:38584490-38584512 AAAGTGGCCTGAGGCTGGGGTGG + Intronic
1159923635 18:74247825-74247847 TGAGTGGACTGGCGCTGAGAAGG - Intergenic
1162086833 19:8254501-8254523 TCATTGGCCTGCCCCTGAGCCGG + Exonic
1164311230 19:24048260-24048282 TTAGAGGCCGGCCACTGAGGTGG + Intronic
937871763 2:126791310-126791332 TGTGTGGGCTGCAGCTGAGGAGG + Intergenic
942942315 2:181632817-181632839 TAAATGGCCTGCTCCTCAGGAGG + Intronic
1173233802 20:41225347-41225369 TCAGTGGCCAGCCTCTGAGTGGG - Intronic
1175659047 20:60796539-60796561 TAGGTTGCTTGCCCCTGAGGAGG - Intergenic
1176159046 20:63639350-63639372 TCTGTGGCCCGCCGCTCAGGAGG - Intergenic
1179592089 21:42415548-42415570 TAAGTGCCCTGCCGTGGAGTGGG + Intronic
1180120131 21:45740304-45740326 GAAGTGACCTGCCAGTGAGGCGG - Intronic
1180629054 22:17214683-17214705 TCAGTGGCCAGTGGCTGAGGAGG - Intronic
1185076851 22:48687756-48687778 TAAGTGCCCCACCTCTGAGGGGG + Intronic
1185420831 22:50733441-50733463 CAAGTGGCCTCCAGCTTAGGAGG - Intergenic
955432075 3:58856496-58856518 TAAGTGGCCTACAGCAGAGAGGG - Intronic
963736523 3:149023290-149023312 AAAGTGTCCTCCCCCTGAGGAGG + Intronic
976088416 4:81429871-81429893 TAAGTGGCCTGCCAGTGTGCTGG - Intronic
983092829 4:163525190-163525212 TAAGGGTCCTGGGGCTGAGGTGG - Exonic
985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG + Intronic
986397408 5:7344306-7344328 TAAGAGACCTGTCCCTGAGGAGG - Intergenic
998040357 5:138947481-138947503 TACCTGGCCTGCGGCTGTGGCGG - Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
1002570808 5:180138312-180138334 GAAGAGGCCTGCCCCTGAGTGGG - Exonic
1016830016 6:148424762-148424784 TCAGTGGCCTGCAGGTGAAGGGG - Intronic
1032531026 7:132620254-132620276 TAAGCGGCCTGCCTCTGATTAGG + Intronic
1037415462 8:18644908-18644930 TAAGGGGCCTGCATCTGATGAGG + Intronic
1044693453 8:94900457-94900479 TAAGGGCCCTCCCTCTGAGGTGG - Intronic
1046579913 8:116079256-116079278 GAAGTGGCCTCCCTCTTAGGTGG - Intergenic
1048572844 8:135669404-135669426 TAAGTGACCTGGCCCAGAGGTGG - Intergenic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1054819027 9:69503777-69503799 CATGTGGCCTGCCGCTCAGAGGG - Intronic
1057546508 9:96022912-96022934 TAAGTGGCCTGTGTCTGTGGGGG - Intergenic
1061452802 9:130677739-130677761 TAAGGGGCCTGCTTCTGGGGTGG - Intronic
1190339611 X:49286298-49286320 GAAGTGGCCTGGCCCTGAGCGGG + Exonic
1190743595 X:53306840-53306862 TTAGGGGCTTGCAGCTGAGGAGG + Intronic
1193372104 X:80711277-80711299 TAAGAGGCCTTCTGCAGAGGTGG + Intronic
1197271238 X:124426895-124426917 TCAGTGCCCTGCCACTGAGAGGG + Intronic
1197814248 X:130480367-130480389 TGAGCGTCCTGCCCCTGAGGTGG - Intergenic
1197841947 X:130757610-130757632 TAAGTGTCCTGTCCCTTAGGTGG + Intronic
1201759708 Y:17523399-17523421 TAAGGGGGCTGCCTCTGAAGGGG + Intergenic
1201841846 Y:18382591-18382613 TAAGGGGGCTGCCTCTGAAGGGG - Intergenic