ID: 998417809 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:141958310-141958332 |
Sequence | TAAGTGGCCTGCCGCTGAGG AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 66 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 63} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
998417805_998417809 | 8 | Left | 998417805 | 5:141958279-141958301 | CCAATTAGAGAAAGAGCATTTCC | 0: 1 1: 0 2: 0 3: 19 4: 199 |
||
Right | 998417809 | 5:141958310-141958332 | TAAGTGGCCTGCCGCTGAGGAGG | 0: 1 1: 0 2: 0 3: 2 4: 63 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
998417809 | Original CRISPR | TAAGTGGCCTGCCGCTGAGG AGG | Exonic | ||