ID: 998419811

View in Genome Browser
Species Human (GRCh38)
Location 5:141973532-141973554
Sequence GAAAATGCACAGAGGCTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 336}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998419811_998419814 6 Left 998419811 5:141973532-141973554 CCGGCCAGCCTCTGTGCATTTTC 0: 1
1: 0
2: 2
3: 32
4: 336
Right 998419814 5:141973561-141973583 TAACTGATTTTAATGTTTTCAGG 0: 1
1: 0
2: 2
3: 56
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998419811 Original CRISPR GAAAATGCACAGAGGCTGGC CGG (reversed) Intronic
900432076 1:2607199-2607221 GTAAAGGCCCAGAGGCTGGGAGG - Intronic
900784011 1:4636393-4636415 GCAGATGCCCAGAGGCTGCCTGG - Intergenic
902269044 1:15289880-15289902 GACACAGCACAGAGGCTGGAGGG - Intronic
902441880 1:16435775-16435797 ATAAATGGACAGAGGCAGGCTGG - Intronic
903062495 1:20679513-20679535 GAGAAGGCAGAGAGGCAGGCAGG + Intronic
903329059 1:22587863-22587885 GAAAATGCACAGATCTGGGCAGG - Intronic
904038513 1:27571367-27571389 GACCAGGCACAGAGGCAGGCTGG + Intronic
904382538 1:30121062-30121084 GAAAAGGCCCAGCGGCTGGAGGG + Intergenic
904627987 1:31818886-31818908 GAAACTGGCCAGAGACTGGCTGG - Intergenic
906326649 1:44850383-44850405 GAAAATGGCTAGAGGCTGGGAGG + Intergenic
906985157 1:50675184-50675206 GAAAATGTACAAGGTCTGGCTGG - Intronic
908029719 1:59986615-59986637 CAAAAGGCAAAGAGGCTTGCGGG - Intergenic
908120672 1:60983398-60983420 GAAGATGCACACAGGCCTGCGGG - Intronic
908412234 1:63878429-63878451 GAAAATGTACAGAGACCGTCAGG - Intronic
908831136 1:68179641-68179663 GAAAATGCTGAGAAGCTGGAGGG + Intronic
908842962 1:68297035-68297057 AAAACTGCACAGTGGCTGGCAGG - Intergenic
909067227 1:70949861-70949883 GAAAATAGAGAGAGGCTTGCTGG + Intronic
910991405 1:93060249-93060271 TAAAAGTGACAGAGGCTGGCTGG + Intergenic
912842016 1:113047212-113047234 GAAAATGCTCACAGGATAGCAGG + Intergenic
914397334 1:147282525-147282547 GAAAATGCAAAGTTGCTGGAGGG - Intronic
914431323 1:147622296-147622318 GGATATTCACAGAGGCAGGCTGG - Exonic
916821481 1:168403115-168403137 AAAAATGCAAAGAAGCTGGGAGG - Intergenic
916887349 1:169082800-169082822 CAAAAGGCACTGGGGCTGGCAGG - Intergenic
917609087 1:176667996-176668018 GAGAATGCACTAAGGCTGGGAGG + Intronic
917785500 1:178452226-178452248 GAAAATTCACAGAGGCCAGATGG - Intronic
918342497 1:183579096-183579118 GAATGTGGACACAGGCTGGCAGG + Intronic
919515435 1:198516273-198516295 GAACATGCACAAAGGCTGAGAGG - Intergenic
919705140 1:200669338-200669360 GAAAATGTACAGGGGGTGGCGGG + Intronic
919905628 1:202076480-202076502 GAACAAGCACAGAGGCCTGCAGG - Intergenic
920720616 1:208383239-208383261 GAAAATCTGTAGAGGCTGGCAGG + Intergenic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
922685705 1:227637447-227637469 GCCAATGCTCAGAGGCAGGCAGG + Intronic
924851712 1:247837730-247837752 GAAGAGGCACAGAGGTTGGGGGG - Intergenic
1062987823 10:1785700-1785722 GCAGGTGCACAGAGGCTGACGGG - Intergenic
1066233114 10:33457134-33457156 GAACAGGCACAGAGGCAAGCTGG + Intergenic
1066388831 10:34962704-34962726 CAAAATGCCCACAGGCAGGCTGG - Intergenic
1067054777 10:43044194-43044216 GCAGCTGCACAGAGGCTGGTGGG + Intergenic
1067461982 10:46465085-46465107 GCAAAGGCACAGAGGCAGGAAGG + Intronic
1067625213 10:47919513-47919535 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1067780259 10:49197301-49197323 GAAAAGGCTCAGGGGCTGGCCGG - Intergenic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1068303729 10:55177513-55177535 GCAACTGCCCAGAGGCAGGCCGG - Intronic
1070670427 10:78373811-78373833 GAAAATGCTGTTAGGCTGGCTGG + Intergenic
1074777976 10:116779933-116779955 GAACATGGACAAGGGCTGGCCGG + Intergenic
1075508814 10:123052047-123052069 GAAAAAGGAGAGAGGCTGGATGG - Intronic
1075538625 10:123293851-123293873 GTCCATGCACAGGGGCTGGCTGG + Intergenic
1075795544 10:125117055-125117077 GAGACTGCACTGAGGGTGGCTGG - Intronic
1076124171 10:127961536-127961558 GAGAATGAACTGATGCTGGCAGG + Intronic
1076212740 10:128661879-128661901 GCAAAAGCCCAGAGGCTAGCTGG - Intergenic
1076366603 10:129925227-129925249 AATGATGCACAGAGCCTGGCTGG + Intronic
1076998305 11:310194-310216 AGAGATGCACAGAGGCTGGAAGG - Intronic
1077228383 11:1448147-1448169 GACACAGCACAGGGGCTGGCAGG - Intronic
1077471791 11:2766737-2766759 GGAATTGGACAGAGGCTGGAAGG - Intronic
1079016896 11:16876493-16876515 GAACATGGACAGAAGATGGCAGG + Intronic
1079241928 11:18727640-18727662 GGGAAGGCACAGTGGCTGGCAGG - Intergenic
1079740719 11:24056217-24056239 GAAAAGGGAGAGATGCTGGCAGG + Intergenic
1082259220 11:50064675-50064697 GGAAAAGAACAGAGGGTGGCAGG + Intergenic
1084727060 11:70948751-70948773 CCACATGCACAGAGGCTGCCTGG + Intronic
1085174640 11:74475140-74475162 AAAAAGGTACAGATGCTGGCAGG + Intergenic
1085525594 11:77161763-77161785 GAAAGACCCCAGAGGCTGGCTGG - Intronic
1086876551 11:92103368-92103390 TAAAATGCACAGAGGATGCAGGG - Intergenic
1089967072 11:122662201-122662223 AAAAAAGCACATCGGCTGGCCGG - Intronic
1090426701 11:126612001-126612023 GAGAGTGCACAGGGGCTGACTGG - Intronic
1091565572 12:1645728-1645750 GAAGAGGCCCAGAGGGTGGCTGG - Intronic
1091893607 12:4082947-4082969 GACATGGGACAGAGGCTGGCTGG + Intergenic
1092230881 12:6774668-6774690 ACCAATGCACAGAGGCTGGGCGG - Exonic
1093743114 12:22710806-22710828 ACAAAGGCACAGAGGCTGACAGG - Intergenic
1093990043 12:25579861-25579883 AAAACTGCTCAGAGGCTCGCTGG - Intronic
1095546129 12:43372542-43372564 GAAACTGGTCAGTGGCTGGCTGG + Intronic
1097839461 12:64307663-64307685 GAAAATGGTCTGAGTCTGGCCGG - Intronic
1097847167 12:64378752-64378774 AAAAATGAACAGAACCTGGCTGG + Intronic
1098466394 12:70791301-70791323 AAAAAGGCTCTGAGGCTGGCGGG - Intronic
1098498165 12:71161085-71161107 GCAAATGCACAGAGTAAGGCAGG + Intronic
1099006736 12:77243000-77243022 TAAAATGAGCATAGGCTGGCTGG + Intergenic
1099112416 12:78578113-78578135 GAAGAGGCACAGAAGCTGACAGG - Intergenic
1099867184 12:88297685-88297707 GAAAATGAACAGACACTGGAAGG - Intergenic
1100102365 12:91124431-91124453 GAAAATGCACAGAGGTTAGAGGG - Intergenic
1101395003 12:104339010-104339032 AAAAATGACCAGAGACTGGCCGG - Intronic
1102200163 12:111052326-111052348 GACAATCCACAGAGGGAGGCCGG - Intronic
1102998172 12:117365357-117365379 GGAAATGGACAGAGTGTGGCTGG + Intronic
1103250185 12:119493188-119493210 GAAAATGCACGGTGGGTGTCAGG - Intronic
1105571665 13:21609309-21609331 GAAAATGCTAGGAGGCTGGGGGG + Intergenic
1105652903 13:22400089-22400111 GAAAACACACATTGGCTGGCTGG - Intergenic
1105928609 13:25031902-25031924 GGAATTGCACAGAAGGTGGCTGG + Intergenic
1106053078 13:26209712-26209734 GGAATTGCACAGAAGGTGGCTGG + Intronic
1106702639 13:32246469-32246491 GTAAAGGCACAGAGGCTGAGAGG + Intronic
1107261953 13:38502966-38502988 GAAAGTGGACAGAGGATGCCAGG - Intergenic
1109071398 13:57773366-57773388 GAAAAATAACAGATGCTGGCAGG - Intergenic
1109302075 13:60600005-60600027 GAAAAGGCACAGAGGGTGGGTGG + Intergenic
1110325531 13:74210625-74210647 GAAAATGCTCAGTAACTGGCTGG - Intergenic
1111969247 13:94893688-94893710 GAAAATGCACACAGGTCTGCAGG + Intergenic
1114493657 14:23118585-23118607 GAGAACGCGCAGAGGCTGGCCGG + Exonic
1117485345 14:56191418-56191440 GAAAATGCAGTGTGGCTGACTGG + Intronic
1118370793 14:65135684-65135706 GAATATGCAGAGAGGGTGCCAGG - Intergenic
1118658312 14:67978396-67978418 GAAAAAACGCAGAGGCTGGAGGG - Intronic
1119208609 14:72812845-72812867 CCAAACGCCCAGAGGCTGGCGGG + Intronic
1119651638 14:76388080-76388102 GGATTTGCACAGAGGCTGTCTGG + Intronic
1119754573 14:77106329-77106351 CAAAATGCATAGAGACTGGGGGG - Intronic
1119767767 14:77201156-77201178 GAGAATCCACAAAGGCTGCCTGG - Intronic
1119824517 14:77646148-77646170 AAAAATTTACAGAGACTGGCTGG + Intergenic
1121250607 14:92497095-92497117 GAAAATTCACAAGGGCAGGCTGG - Exonic
1121565212 14:94904252-94904274 GAAGATGCCCAAAGGCTGGGGGG + Intergenic
1121882073 14:97509702-97509724 GAGAAAGAACAGAGGCTGGAAGG - Intergenic
1122168053 14:99845752-99845774 GAAAATTGACAGAGCCTGGCTGG + Intronic
1123972212 15:25517902-25517924 AAAAATGCACAGAGGGGGCCGGG - Intergenic
1124348067 15:28935477-28935499 GGAAATGGACAGTGGCTGTCAGG + Intronic
1124845396 15:33284846-33284868 GAAAAAGCAAAGAGGGTGGAAGG + Intergenic
1127857731 15:62966559-62966581 GAAGGTGCTCAGAGGCAGGCTGG - Intergenic
1128536606 15:68495967-68495989 GAAAAGGCAAGGAGGATGGCAGG + Intergenic
1128940637 15:71785010-71785032 GAAAAAGCCCAGAGGATGGTAGG + Intergenic
1129144045 15:73632334-73632356 GAAAATGAGCAGAGGATGGAGGG - Intronic
1129168387 15:73792712-73792734 GGGCAGGCACAGAGGCTGGCAGG - Intergenic
1129475979 15:75784954-75784976 GAGAAGGCACAGAGGTTGCCAGG - Intergenic
1129721870 15:77881987-77882009 GAAAATGAACAGGGGCTTGTGGG + Intergenic
1130192485 15:81750211-81750233 CAAGATGCTCAGAGGCCGGCTGG - Intergenic
1131188305 15:90293787-90293809 GAGAAGGCACAGAGGTTGCCAGG - Intronic
1131282522 15:91033009-91033031 GAGAAGGCACAGAGGTTGGCAGG + Intergenic
1132077084 15:98830898-98830920 GAAAATGATCAGATCCTGGCCGG - Intronic
1134053346 16:11153003-11153025 GACAATGCTCAGAGGCTGCGGGG - Intronic
1134313674 16:13098767-13098789 GAAATTGCAAAAAGGCTGGGTGG + Intronic
1135747807 16:25032068-25032090 GAATACGCTCGGAGGCTGGCAGG + Intergenic
1135873558 16:26175611-26175633 GAAAAAGAACAGGAGCTGGCAGG + Intergenic
1136298597 16:29318121-29318143 GAAAATGCACAGATGGGTGCAGG - Intergenic
1137727157 16:50664854-50664876 GAAAATGGAAGGAGGCTGGGAGG - Intergenic
1137772290 16:51025974-51025996 GAAAAATCACAGTGGCAGGCAGG + Intergenic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1143436869 17:6935350-6935372 GAAAAATAACAGATGCTGGCCGG - Intronic
1143988768 17:10938828-10938850 GAAAATGCACAGGTACTGGAGGG + Intergenic
1144210410 17:13010004-13010026 AAAAATGTACGGAGGCTGACAGG + Intronic
1144631121 17:16873059-16873081 GAAAATGTCCAGAGACTGCCGGG - Intergenic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1147338924 17:39742495-39742517 GATAATACACAGAGGCTTGCAGG + Intronic
1148441321 17:47713137-47713159 GAAAAGGCACAAAGGATGGCTGG + Intergenic
1148929067 17:51113381-51113403 GAAAAAGCAAATAGGTTGGCCGG + Intronic
1149256367 17:54831893-54831915 TAAAATACACAAAGACTGGCCGG + Intergenic
1152127841 17:78458098-78458120 TAAAAAGTACAGAGGCTGGCTGG - Intronic
1152181365 17:78823690-78823712 GAGAAGGCAAAGAGGCAGGCAGG + Intronic
1152242953 17:79169654-79169676 GCAAATCCACAGAGGCTGGCAGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152320323 17:79605311-79605333 GAAACTGTTCAGGGGCTGGCTGG + Intergenic
1154493191 18:14936868-14936890 TGAGATTCACAGAGGCTGGCTGG + Intergenic
1156291964 18:35755258-35755280 AAATATGCTCACAGGCTGGCAGG + Intergenic
1157452475 18:47799168-47799190 GAGACTGAACAGAGGCTTGCTGG + Intergenic
1157744275 18:50121025-50121047 GAAAATGCCCAGAGGAGAGCAGG - Intronic
1161195093 19:2982239-2982261 GAGAAAGCACAGAGGGGGGCCGG + Intronic
1163918652 19:20266328-20266350 GAAAATACACAGTGTATGGCCGG - Intergenic
1164090763 19:21949787-21949809 AAAACTGCTCAGAGGCAGGCTGG - Intronic
1165367978 19:35381288-35381310 GAAAACGAACAAAGGCAGGCAGG - Intergenic
1165914135 19:39247652-39247674 GAGGATGCAGAGAAGCTGGCGGG + Intergenic
1165916736 19:39265286-39265308 GAGGATGCAGAGAAGCTGGCGGG - Intergenic
1166146995 19:40844823-40844845 GAAAGTACACAGGGGCTGGAGGG + Intronic
1166151153 19:40876719-40876741 GAAAGTACACAGGGGCTGGAGGG + Intronic
1166296040 19:41890012-41890034 CAAAATGCCCAGAGGCCGCCGGG - Intronic
1166499655 19:43331289-43331311 GAGGAAGCACAGAGACTGGCTGG - Intergenic
1167119159 19:47506551-47506573 GAAAAAGCACAGACCCTGGATGG + Intronic
1167375118 19:49107090-49107112 GAGAATGCACAGACACTGGCAGG + Intronic
925472545 2:4177912-4177934 GAGAAAGCACACAGCCTGGCTGG - Intergenic
925622499 2:5807555-5807577 CAACATTCCCAGAGGCTGGCAGG - Intergenic
925933454 2:8730517-8730539 CAAAGACCACAGAGGCTGGCTGG + Exonic
926882914 2:17568355-17568377 GAAAATCACCAGAGGCTGGAAGG - Intronic
926933428 2:18063086-18063108 ACAAATGCACAGAGCCTGGCCGG - Intronic
926943108 2:18158842-18158864 GCAAAAGCACAGATGGTGGCTGG + Intronic
928245276 2:29621412-29621434 GACAATGGCCAGAGGCTGGGAGG - Intronic
929377652 2:41309171-41309193 GAAAATGTAGAGAGACTGTCAGG + Intergenic
929870009 2:45751096-45751118 GCAAAGGCACAGAGGCTGAAAGG - Intronic
930153205 2:48078867-48078889 GAAAAGGCACAGAGACAGGCCGG - Intergenic
930852855 2:55980008-55980030 GAAAATGCACATAGAATGCCTGG + Intergenic
932308963 2:70724617-70724639 GCAAAAGCAGAGAGCCTGGCAGG - Intronic
932423858 2:71616999-71617021 GGAAATGGACAGGGGGTGGCAGG - Intronic
932613933 2:73220089-73220111 GAGAATGCCCAGAGGCTGACCGG + Exonic
932713025 2:74081602-74081624 GCAAAGGCAGAGAGGCTGGGTGG + Intronic
933939990 2:87237029-87237051 GAAACTGCAAAGAGGCTTGAGGG - Intergenic
934913229 2:98277703-98277725 GAAAATGCACACAGGGAGGCAGG + Intronic
936353150 2:111728749-111728771 GAAACTGCAAAGAGGCTCGAGGG + Intergenic
937125632 2:119473522-119473544 GAAACTGCACACAGGATGGCTGG - Exonic
937505938 2:122536422-122536444 GAAATTTCAGAGAAGCTGGCAGG + Intergenic
937531284 2:122830382-122830404 GACAATGAAAAGAGGCTGACTGG - Intergenic
938242850 2:129756556-129756578 GACAATGCACTGAGACTAGCAGG + Intergenic
938375535 2:130803352-130803374 AAAGATCCACAGAGGATGGCAGG - Intergenic
940115181 2:150200869-150200891 GAACATGAACAGAAGCTGTCTGG + Intergenic
943382996 2:187173602-187173624 GCAAATGCTCGGGGGCTGGCTGG + Intergenic
943771957 2:191727651-191727673 GAAAAACCACAGAGGCAGGAAGG + Intergenic
944663357 2:201939461-201939483 GATGATGCACAGAGTCGGGCAGG - Intergenic
945113636 2:206389415-206389437 GAGAAAGCACAGAGGGTGACTGG + Intergenic
945424250 2:209680386-209680408 GAAAACACACACAGGCAGGCAGG - Intronic
948547310 2:238742082-238742104 GAAAAAGAACAGAGGCAGGGTGG + Intergenic
1171079004 20:22158629-22158651 GACCATGTCCAGAGGCTGGCAGG + Intergenic
1171366490 20:24628374-24628396 GAATAAGCAGAGTGGCTGGCAGG - Intronic
1171454087 20:25257111-25257133 GAAACTGAAAAGAGGCTTGCTGG - Intronic
1172287345 20:33750094-33750116 GAAAATGCACAGTAGCTCCCTGG + Intronic
1172816333 20:37690075-37690097 GAAAAGGTGGAGAGGCTGGCTGG - Intergenic
1172949465 20:38713454-38713476 GGCAAAGCACAGAGGGTGGCAGG + Intergenic
1173354861 20:42277712-42277734 GAACAGAAACAGAGGCTGGCTGG + Intronic
1174294628 20:49536883-49536905 GAAAACACACAGATGCTGGGAGG + Intronic
1174449132 20:50609097-50609119 GAAAATGGACAGAGGGTGCTGGG + Intronic
1174498545 20:50967085-50967107 AAAAATGCACAAATCCTGGCTGG + Intergenic
1175482219 20:59319777-59319799 GAAAATGCAGAGGGGATGTCAGG + Intronic
1175639985 20:60620881-60620903 CAAGCTGCACACAGGCTGGCAGG + Intergenic
1176047732 20:63101377-63101399 GAGAAAGCACACAGGCTGTCGGG + Intergenic
1179099976 21:38347909-38347931 GAGAAAGCCCAGAGCCTGGCAGG + Intergenic
1181316379 22:21973364-21973386 GAAGATGGACTGAGGCTGGGAGG - Intronic
1181641491 22:24202467-24202489 GAAAAGGCAGAGGGGCTGGGAGG - Intergenic
1181676257 22:24455405-24455427 GAAAATGCATAGAGCCTAGGAGG - Intergenic
1182415319 22:30217700-30217722 GAAAGTGGCCACAGGCTGGCTGG - Intergenic
1183399635 22:37594720-37594742 GAAAAGGCCCACAGGCTGGGAGG + Intergenic
1183407343 22:37636857-37636879 AAATCTGCACAGAGGCTGCCAGG + Intronic
1184466699 22:44672734-44672756 GTCTATGCACAGGGGCTGGCTGG - Intronic
1184803662 22:46777617-46777639 GGGCATGCAGAGAGGCTGGCAGG + Intronic
949583253 3:5412210-5412232 AAAACTGTACTGAGGCTGGCAGG + Intergenic
950188514 3:10960263-10960285 GAAGAGGCCCTGAGGCTGGCAGG - Intergenic
951434241 3:22643310-22643332 GAAAATCTAGAGAGGCTGTCTGG + Intergenic
951683354 3:25317892-25317914 GAAAATTCAGACAGGCTGGGTGG - Intronic
951708592 3:25567974-25567996 GAGAATGCAAAGAAGCCGGCGGG - Intronic
952046269 3:29324810-29324832 GAAAAGGCAGATAGGCAGGCAGG - Intronic
952909609 3:38171151-38171173 GAAAATGGAGAGAGGCTGTCAGG - Intronic
953039331 3:39241003-39241025 AAATCTGCAGAGAGGCTGGCAGG - Intergenic
954806973 3:53226285-53226307 GACTATGGACAGTGGCTGGCTGG - Intronic
954930279 3:54275236-54275258 GCAAAGGCACAGAGGTGGGCCGG - Intronic
954931997 3:54291605-54291627 GAAACAGAACAGAGCCTGGCGGG + Intronic
956705756 3:71997645-71997667 GAAGTTGAGCAGAGGCTGGCAGG - Intergenic
957724311 3:84045163-84045185 GAAAATTCACAGAGGCTCTAGGG - Intergenic
958453809 3:94305634-94305656 GCAAATGCACAGAGGATTCCTGG - Intergenic
959179725 3:102963076-102963098 GGAAATGCATTGATGCTGGCAGG + Intergenic
959257211 3:104030924-104030946 GAAACTGCACAGAGCCCGGAAGG + Intergenic
961337070 3:126186944-126186966 GAAACTGCACGGACGCTGGGAGG + Intronic
961338765 3:126203280-126203302 GAAAATGCAGAGAAGGGGGCTGG + Intergenic
961357027 3:126345778-126345800 GACAAGGCACAGGGGGTGGCAGG + Intronic
961467805 3:127092133-127092155 GCAAAGGCCCTGAGGCTGGCAGG + Intergenic
961610630 3:128134489-128134511 GAAAATACACAGAGGTGGCCAGG + Intronic
961646991 3:128397977-128397999 GTCAGTGCACAGAGGCTGGGGGG - Intronic
962045962 3:131759199-131759221 GAAAAGCCACTGAGGTTGGCAGG + Intronic
962297216 3:134201644-134201666 GAAAATGCATGGAGGCTTGTGGG + Intronic
963781009 3:149486726-149486748 GAAAATGCTCCGAGGGTGGAAGG + Intronic
963796889 3:149639695-149639717 GAAAAAGTACAGAAGTTGGCTGG + Intronic
964720301 3:159763622-159763644 GAGCATGCCCAGAGGCTGCCGGG - Intronic
966009758 3:175060213-175060235 GAAAGTGCTCATAGGCTGCCAGG + Intronic
966814779 3:183881104-183881126 AAAAATGCACAAAGGCTGTGCGG - Intronic
966983504 3:185159132-185159154 GAGAAGGCACTGAGGCAGGCAGG - Intergenic
967926521 3:194653216-194653238 TAAGATGGACAGAGGATGGCTGG + Intronic
968066891 3:195763825-195763847 GAAAATGCAAGGAGGCTTGAGGG - Intronic
968199523 3:196740158-196740180 GTAAGTGCACACAGGCCGGCCGG + Intronic
968500029 4:945566-945588 GAGAATGGACAGAGGCTCACTGG - Intronic
968716700 4:2165390-2165412 TAAAAAGCACAGTGGCTGTCAGG + Intronic
969544332 4:7814772-7814794 GAAAGAGCACAGGGGCTGGGGGG + Intronic
972168716 4:36318907-36318929 GAAAATGCACAGAAGAGGCCAGG - Intronic
974243591 4:59284096-59284118 GAATATTCACAGAGGATGGCAGG + Intergenic
974645369 4:64683576-64683598 GAAATGGCCCAGAGGCTGCCGGG + Intergenic
976799294 4:88970910-88970932 GAAAAAGCACAGAAGTTGGCCGG + Intronic
977475284 4:97499716-97499738 GCAAATGAACAAAGGCTGGAAGG + Intronic
985760991 5:1748636-1748658 AAAGATGCCCAAAGGCTGGCAGG + Intergenic
985850354 5:2384022-2384044 GGAAATGCACAAAGTCAGGCTGG + Intergenic
985883180 5:2656366-2656388 GAAAATTCCCGAAGGCTGGCCGG - Intergenic
986220435 5:5764027-5764049 GGTAATTGACAGAGGCTGGCTGG + Intergenic
986352408 5:6892829-6892851 GAAAATGCACAATAACTGGCTGG - Intergenic
986873637 5:12080309-12080331 GATAGTGCACAGAGCCTGGGAGG + Intergenic
986958557 5:13186690-13186712 GAAAATGCAAACAAGCAGGCAGG - Intergenic
988864289 5:35317706-35317728 GACAATGGACAGGGCCTGGCAGG + Intergenic
989304450 5:39936531-39936553 GAGAAAGAACAGAGGATGGCTGG + Intergenic
990134146 5:52624794-52624816 AAAAAATAACAGAGGCTGGCAGG - Intergenic
990826377 5:59903803-59903825 GACACTGCAGAGAGGCAGGCAGG - Intronic
991695742 5:69269291-69269313 GAAAATGCATAAAGGCTTACCGG - Exonic
991920891 5:71655916-71655938 TAAAATGTACTGAAGCTGGCCGG + Intronic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
992879174 5:81088181-81088203 GGAAAGGCACAGAGGCTGGCAGG - Intronic
993650099 5:90509681-90509703 GAACATGGAGAGAGGCTTGCAGG + Intronic
995417021 5:111923649-111923671 GCAACTGCCCAGAGGCAGGCTGG + Intronic
997378292 5:133414833-133414855 GAAAATGAAAATAGGCTGTCTGG - Intronic
997599611 5:135130327-135130349 CAAAAGGCACAGAGTCTGTCTGG - Intronic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
999150661 5:149424057-149424079 GAAAATAAACAGTGGCTGTCTGG - Intergenic
999417884 5:151415807-151415829 GAAAGTACACAGAGTCAGGCTGG + Intergenic
999823065 5:155248096-155248118 GAAATTGCGCAGAGCCTGACAGG - Intergenic
1001112506 5:168909018-168909040 GAAAATGCAAGAAGCCTGGCGGG - Intronic
1002351597 5:178587799-178587821 GGAAATGTACACAGCCTGGCCGG - Intronic
1002954265 6:1846538-1846560 GAAAACTCTAAGAGGCTGGCAGG + Intronic
1003039491 6:2673942-2673964 GAAGATGTACGGGGGCTGGCTGG + Intronic
1003070651 6:2942902-2942924 GAAAAAGGAGTGAGGCTGGCAGG + Intergenic
1004174065 6:13323653-13323675 AAAAGTGCACAGAGACTGCCAGG + Intronic
1004953398 6:20700553-20700575 GAAGTTGCACAGCAGCTGGCAGG + Intronic
1005097916 6:22138666-22138688 GAACATGCACAGAGAAAGGCTGG + Intergenic
1005352934 6:24954187-24954209 GAGGATGCTCAGAGGCAGGCTGG + Intronic
1005869636 6:29965274-29965296 GAGAATGCTGAGAGGTTGGCAGG + Intergenic
1006010278 6:31037293-31037315 GACAAAGCAGACAGGCTGGCAGG - Intergenic
1006365032 6:33610269-33610291 GAAAAGGCCCAGAGGCAGGAAGG - Intergenic
1007726740 6:43921347-43921369 GAGAAGGCACAGAGGCGGGCAGG + Intergenic
1008731201 6:54484711-54484733 GAAAATGCACAGGAGCTGGGAGG - Intergenic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1011370525 6:86632653-86632675 AAAAAACCACAGATGCTGGCAGG - Intergenic
1011497713 6:87952798-87952820 TAAAATTGACAGGGGCTGGCCGG - Intergenic
1013000151 6:106013793-106013815 GCAAGTGAACAGAGGCTGGGAGG - Intergenic
1013207142 6:107955456-107955478 AAAAATGCAGTGAGGTTGGCCGG - Intronic
1013584211 6:111564450-111564472 AAAAATGCACTGCTGCTGGCTGG - Intronic
1013614361 6:111827904-111827926 CTAACTGCACAGAGGCAGGCAGG + Intronic
1015498729 6:133908334-133908356 GCAAGAGCACAGAGGCTGACGGG - Intergenic
1015961743 6:138657252-138657274 GAAGATCCACAGATCCTGGCAGG + Intronic
1016644996 6:146397184-146397206 TAAAAAGCACAAAAGCTGGCTGG + Intronic
1017633743 6:156423627-156423649 GAAAATGCAGGGATGCTGGGAGG + Intergenic
1018299502 6:162386181-162386203 GAAAATGCTGAGAGACTGGATGG + Intronic
1019762875 7:2826751-2826773 GTAAACGCTCAGAGGCTGCCAGG + Intronic
1019978982 7:4606997-4607019 GAAAATAAAGAGAGGCTGGCTGG - Intergenic
1020018124 7:4843566-4843588 CAAAATGCCCAGAGTCAGGCTGG - Intronic
1020611486 7:10402906-10402928 GAACATCCTCAGAGACTGGCAGG + Intergenic
1021781970 7:24115066-24115088 TAAAAAGCACAGAAGCTGGAGGG + Intergenic
1022042026 7:26590562-26590584 GAAGCTGCTCAGAGTCTGGCTGG + Intergenic
1022532600 7:31076383-31076405 GGAACTCTACAGAGGCTGGCAGG + Intronic
1022533916 7:31084159-31084181 GGAACTGCACGGAGGATGGCTGG + Exonic
1022720657 7:32939474-32939496 GACATTTCACAGAGGCTGGTGGG - Intergenic
1024709232 7:51996355-51996377 GAACATGCACAGAGGCCAGAAGG - Intergenic
1024807528 7:53162507-53162529 GAAAATGCACTGGGGCTTCCTGG - Intergenic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1027368966 7:77487738-77487760 AAGAATGCACAAAGGTTGGCCGG + Intergenic
1027427940 7:78080960-78080982 GACAATGAAAAGAGGTTGGCGGG - Intronic
1027931274 7:84538031-84538053 GAAAATGTAAAGAGGCGGCCTGG - Intergenic
1028481379 7:91309625-91309647 GAAAAAACACAGAGGCCGGGAGG - Intergenic
1032325277 7:130922222-130922244 GAAAACGCTCAGAGGCTGCCAGG + Intergenic
1032380194 7:131471349-131471371 GAAAATGAAGAGAGGTTGGTGGG + Intronic
1034054639 7:148021692-148021714 GAGAATGCAGACAGGGTGGCAGG + Intronic
1034797536 7:154027948-154027970 GGAAATAAACTGAGGCTGGCAGG - Intronic
1035271713 7:157723638-157723660 GAACTTCCACAGTGGCTGGCAGG - Intronic
1035610332 8:958057-958079 AAGAATGAACAGAGGCTGCCAGG - Intergenic
1036219590 8:6910304-6910326 GAAAATGGAAAGAGGCCTGCTGG + Intergenic
1036516357 8:9447726-9447748 GAAAAAGCACAGCAGTTGGCCGG + Intergenic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1039968296 8:42299601-42299623 GATCATGCCCAGAAGCTGGCAGG - Intronic
1041040330 8:53840164-53840186 AAAGATGCACAGGGTCTGGCAGG - Intronic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045480136 8:102585241-102585263 GTAACAGCAGAGAGGCTGGCAGG + Intergenic
1047209823 8:122832359-122832381 GCCAATGCTCAGAGGCAGGCAGG + Intronic
1047574270 8:126135778-126135800 GAAAATGCCAACAGCCTGGCCGG + Intergenic
1047916074 8:129584987-129585009 GAAAGGGCACAGAGAGTGGCAGG - Intergenic
1048545389 8:135381992-135382014 GAAAATGCTCAGAGGCATTCTGG - Intergenic
1048630847 8:136240723-136240745 GAAAATGAGCAGAAGCTGGCTGG - Intergenic
1049035745 8:140074507-140074529 GGAGATGCACAGAAGATGGCAGG + Intronic
1049163434 8:141112030-141112052 GAATGTGCAGAGGGGCTGGCAGG + Intergenic
1051213427 9:14770548-14770570 TAAAATACCCAGTGGCTGGCAGG - Intronic
1051698016 9:19789437-19789459 GAAAAGGCACGGAGGCCTGCAGG + Intergenic
1052198746 9:25751095-25751117 GAAAATGCACAGAGCCTATGAGG - Intergenic
1052827135 9:33185451-33185473 GCAAAAGCAAAGAGACTGGCTGG + Intergenic
1052842638 9:33306080-33306102 AAAAAAGCACAGAGGCAGGGAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053402644 9:37839772-37839794 GAATAAGCAAAGAGGGTGGCTGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055513976 9:77019254-77019276 GAAAAAGCAAAGAGGCCGGGAGG + Intergenic
1056084909 9:83137820-83137842 GTAAATGCTCAGAGGCAGGAGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057706755 9:97400116-97400138 GAAAATGCACAGAGTCTAAAAGG - Intergenic
1058199607 9:102022871-102022893 GAAAAACAACAGATGCTGGCAGG - Intergenic
1059887978 9:118768249-118768271 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1060977917 9:127776342-127776364 CCAGGTGCACAGAGGCTGGCTGG - Intronic
1061553480 9:131351170-131351192 GATAATGAACAGTGGCTGGCCGG + Intergenic
1061886539 9:133593814-133593836 GACACTGCCCAGGGGCTGGCAGG + Intergenic
1061886646 9:133594377-133594399 GAAAATGCAAAGTTGGTGGCTGG - Intergenic
1061886731 9:133594858-133594880 GCAAAGGCCCAGAGGCAGGCAGG + Intergenic
1062465639 9:136679788-136679810 GAACAGGCCCAGCGGCTGGCAGG + Intronic
1062590368 9:137271893-137271915 GGAAGTGGACAGAGGCAGGCAGG - Intronic
1186553069 X:10527593-10527615 GAAAAGGCACAGGTGCTTGCAGG - Intronic
1188656827 X:32707433-32707455 GCAAATGCACAGAAGCTGGTGGG + Intronic
1190128876 X:47728592-47728614 AAAAATGAACAGAAACTGGCCGG - Intergenic
1190888537 X:54549963-54549985 GAGCATGGACAGAGGCTGACAGG + Intronic
1193047790 X:77070680-77070702 GAGGATGCAGAGAGGCTGGCAGG + Intergenic
1194123740 X:89989852-89989874 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1195651879 X:107293317-107293339 GAAAATGAAGTGAGGCTGCCAGG + Intergenic
1196783338 X:119401587-119401609 GCAAATGCACAGAGGTGGGAAGG + Intronic
1198251761 X:134885896-134885918 GATAATGCAGCTAGGCTGGCTGG + Intergenic
1198332232 X:135632412-135632434 GAAAATGAACAAAGTCTGGAGGG + Intergenic
1198334008 X:135649891-135649913 GAAAATGCATAAAGCCTGGCAGG - Intergenic
1199449821 X:147966787-147966809 AAAAATTAACAGATGCTGGCGGG + Intergenic
1200476626 Y:3647473-3647495 GCAACTGCCCAGAGGCAGGCTGG + Intergenic
1201337248 Y:12894145-12894167 GCAACTGCTCAGAGGCAGGCTGG - Intergenic