ID: 998420216

View in Genome Browser
Species Human (GRCh38)
Location 5:141978445-141978467
Sequence CTCAGAAAAAAGTGCAGAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 594}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998420212_998420216 25 Left 998420212 5:141978397-141978419 CCCTAGCATACTTGAATATTGTC 0: 1
1: 0
2: 3
3: 13
4: 110
Right 998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG 0: 1
1: 0
2: 4
3: 57
4: 594
998420213_998420216 24 Left 998420213 5:141978398-141978420 CCTAGCATACTTGAATATTGTCT 0: 1
1: 0
2: 1
3: 9
4: 150
Right 998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG 0: 1
1: 0
2: 4
3: 57
4: 594
998420215_998420216 -1 Left 998420215 5:141978423-141978445 CCTTTTGAGCTCAAGATTGGTTC 0: 1
1: 2
2: 0
3: 7
4: 91
Right 998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG 0: 1
1: 0
2: 4
3: 57
4: 594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998420216 Original CRISPR CTCAGAAAAAAGTGCAGAGA AGG Exonic
900699669 1:4037934-4037956 CTCAGCAAAATCTGCATAGAAGG + Intergenic
901472480 1:9467298-9467320 CTCAGATAGAACTGCAGAAAAGG + Intergenic
901924250 1:12555795-12555817 CTGTGTAAAGAGTGCAGAGACGG - Intergenic
902123300 1:14186442-14186464 CTCAGAAAAGATAGGAGAGAGGG + Intergenic
902278664 1:15358604-15358626 CTCAGAACACCGTGCAGAGAGGG - Intronic
902769669 1:18638234-18638256 CTGAGAAAAAAGGGAAGGGAAGG + Intronic
904709508 1:32418364-32418386 CCCAGACAGAAGTGCAGATAAGG - Intergenic
904830213 1:33301473-33301495 CTCAGAACAGAGTGGAGAGCTGG - Intergenic
905000672 1:34666155-34666177 CTCACAAAAAATGGCAGAGTGGG - Intergenic
905445757 1:38027578-38027600 CTCAGCAAAAAGTGCAGGGAAGG + Intergenic
906637797 1:47421169-47421191 CTAAGAAAAAAGGGAAGATAGGG - Intergenic
908332355 1:63083233-63083255 CTCAGGACAGAGTGCAGAGGAGG - Intergenic
908578167 1:65483937-65483959 CTCAAAAAAAAAAGGAGAGAAGG - Intronic
909064806 1:70922548-70922570 CCCAGACAGAAGTGCAGATAAGG - Intronic
909283091 1:73782112-73782134 CTCAGAAAAAAGAGAAGTTAAGG - Intergenic
909298860 1:73985195-73985217 CTCAGCAAAATGTGCATAGAAGG - Intergenic
909486081 1:76175628-76175650 ATCAGAAAAAAGTACAGAATAGG + Intronic
909840307 1:80312793-80312815 CTCACAGAACAATGCAGAGAGGG - Intergenic
909887604 1:80962219-80962241 TCCAGAAACAAGTGCTGAGATGG - Intergenic
910744581 1:90559423-90559445 CTCAGAAATAACTGTAGTGATGG - Intergenic
911069971 1:93824849-93824871 CACAGAACAAAGTGCCCAGAGGG - Intronic
911474518 1:98359211-98359233 TTTACAAAAAAGTGCACAGATGG - Intergenic
911945085 1:104096878-104096900 CTCAGAAAGAATTGCAGATGTGG + Intergenic
911945423 1:104101249-104101271 CTCAGAGAATAGTACATAGAAGG + Intergenic
912392384 1:109312912-109312934 GTCAGAAAAAAGGGGTGAGAAGG + Exonic
912407616 1:109453578-109453600 CTCAGAAGAAAGAGAAGGGATGG - Intergenic
913254437 1:116941103-116941125 ATCAGAACAAAGAGTAGAGAAGG + Intronic
915230698 1:154443436-154443458 TGCAGAAAACAGGGCAGAGAGGG - Intronic
915374780 1:155384087-155384109 CTTAGAAAAAACTCAAGAGAAGG + Intronic
916441734 1:164833136-164833158 AGCAAAAAAAAGTTCAGAGAAGG + Intronic
916583397 1:166128591-166128613 GTCAGAAAATAGAGGAGAGAAGG + Intronic
916643521 1:166758311-166758333 CACAGAAGAAAGTGCTGAGTGGG + Intergenic
917179505 1:172280019-172280041 CTCAGAAATGAGTTCAGAGAAGG - Intronic
917327522 1:173848152-173848174 CTCAGAAAAGAATGAAGAAAAGG - Intronic
917802429 1:178582555-178582577 CTCAAAAGAAAATGCAAAGATGG + Intergenic
918571833 1:186003660-186003682 CTCAGCAAAAAGAGCAGGCATGG - Intronic
918749596 1:188256479-188256501 CTCAGCAAAAAGGGCACATAAGG - Intergenic
919648778 1:200124503-200124525 CACAGAGAAATGTGCTGAGAGGG - Intronic
920990134 1:210929496-210929518 CTCAGCAAAATCTGCAGAGAAGG + Intronic
922118907 1:222643437-222643459 CTGAGAAAGAAGAGCAGTGAAGG - Intronic
922174126 1:223181840-223181862 GCCAGAAACAGGTGCAGAGAAGG + Intergenic
922818215 1:228466313-228466335 TTCACAAGAAAGTGCACAGATGG - Intergenic
923691619 1:236199070-236199092 CTCAGAAAAACTGGCATAGAAGG - Intronic
924002432 1:239568666-239568688 CTGAGGAAAAAGAGCAGAGGAGG - Intronic
924002435 1:239568689-239568711 CTGAGGAAAAAGAGCAGAGGAGG - Intronic
924109068 1:240680017-240680039 CTCAGCAAAAAGAGCAAAGCTGG + Intergenic
924120460 1:240792633-240792655 CTCTTAAAACAGTGCAGAGTAGG - Intronic
924328465 1:242919266-242919288 TTAAAAAAAAAATGCAGAGAGGG + Intergenic
1062801092 10:380987-381009 TTCAGAAAACAATGCAGAGAGGG + Intronic
1063257319 10:4342547-4342569 CTCTGCAAAAAGTGGAGAGTTGG + Intergenic
1063308454 10:4930087-4930109 CTCAGAAGAAACTAGAGAGATGG + Intronic
1063318219 10:5027395-5027417 CTCAGAAGAAACTAGAGAGATGG - Intronic
1065569428 10:27054800-27054822 CCCAGAGAAAAGGGCAGAAAGGG + Intronic
1065663187 10:28027323-28027345 CTCAGAAAAATGGGAAAAGAGGG - Intergenic
1066265612 10:33773520-33773542 CTAAGAAAAAAATTCAGAAAAGG - Intergenic
1066396473 10:35028809-35028831 ATTAGAAAAAAGTGTACAGATGG - Exonic
1066506305 10:36048432-36048454 CTAAAAAAAAAGTGAGGAGAAGG + Intergenic
1068643919 10:59444285-59444307 ATAAAAAAAAATTGCAGAGATGG + Intergenic
1069820047 10:71221843-71221865 CTCAGAACTAAGCTCAGAGAGGG - Intronic
1069877179 10:71570279-71570301 CTCAGAAGAAAGGCCACAGAGGG - Intronic
1070405014 10:76086878-76086900 CACAGAAAAAAGGGCTGAGTGGG + Intronic
1070913785 10:80139674-80139696 CTCAAAAAAAAGTGGGGAGGGGG + Intronic
1070959343 10:80487933-80487955 CTGAGAAAGAAGTGCCAAGAAGG - Intronic
1071113102 10:82185396-82185418 CCCAGAATAAAGCTCAGAGATGG - Intronic
1071710409 10:88043840-88043862 CCCAGAAAACAGTGGTGAGAAGG - Intergenic
1072156868 10:92731465-92731487 CTCCAAAAGAAGTGCTGAGAAGG - Intergenic
1072451434 10:95542221-95542243 CTGAGAGTAAAGTGGAGAGATGG - Intronic
1073079206 10:100847246-100847268 CTAAGAACAAAGTCCAGAGGAGG - Intergenic
1073525112 10:104173704-104173726 CTCAGTAAAAAGTGAAGGGGTGG - Intronic
1073701256 10:105929485-105929507 CTCAGCAAAATCTGCATAGAAGG + Intergenic
1073802743 10:107060487-107060509 GTCTGAACAGAGTGCAGAGAAGG - Intronic
1074924380 10:118052537-118052559 ATCAGGTAAAAGTACAGAGAGGG + Intergenic
1074975259 10:118575627-118575649 CTCAGAAAAATGGGAATAGAGGG + Intergenic
1075234337 10:120712743-120712765 CTTGGAGAAAAGTGCAAAGAGGG + Intergenic
1075951295 10:126479747-126479769 CTAAAAATAAAATGCAGAGAAGG + Intronic
1076215036 10:128686716-128686738 CAGAGCAAAAGGTGCAGAGAGGG + Intergenic
1076467357 10:130693081-130693103 CTCAGAAAAAAGAAAAGAAAAGG - Intergenic
1077303307 11:1856878-1856900 CTCAGGAAAGAGGGCAGAGCTGG + Intronic
1077720533 11:4624104-4624126 CCCAGACAGAAGTGCAGATAAGG + Intergenic
1077750810 11:4966557-4966579 CTAAGAAGAGAGTTCAGAGATGG + Intronic
1078291575 11:10015802-10015824 CTCAAAAAAAAAAGCAAAGAGGG - Intronic
1078294667 11:10056182-10056204 CTCAGCAAAAAGAGCAAAGCTGG - Intronic
1078295258 11:10061892-10061914 CTCAGCAAAAAGAGCAAAGCTGG + Intronic
1078887947 11:15524154-15524176 CTCAGGAAGAAATGTAGAGATGG + Intergenic
1079015625 11:16866289-16866311 CTCAGTAAAGAGGGCAGAGCAGG + Intronic
1081444117 11:43113486-43113508 CTCAGATAAAAGAGCAGAAAGGG + Intergenic
1081634640 11:44712703-44712725 CTCAGACAAAAATGCAGTGGGGG + Intergenic
1081876432 11:46411467-46411489 CTCAGAAAAAAAGGCAGATTTGG - Intronic
1081990482 11:47334864-47334886 CTAGGGAAAAAGTGCAGAGAGGG - Intronic
1082092824 11:48103852-48103874 CACAGAAAAAAGTACCCAGAAGG - Intronic
1082875729 11:57986387-57986409 GTAAGAATGAAGTGCAGAGAAGG + Intergenic
1085262557 11:75215966-75215988 CTCAGTAAAAAATGGATAGATGG + Intergenic
1086320559 11:85642917-85642939 CTCCAAAAAAATTGAAGAGATGG + Intergenic
1086819313 11:91415263-91415285 CTCAGCAAAATAGGCAGAGATGG + Intergenic
1087020303 11:93595955-93595977 AAAAGAAAAAAGTGGAGAGATGG - Intergenic
1087916048 11:103812069-103812091 ATCAGACTAAAGTGCAGGGAAGG + Intergenic
1088185934 11:107169862-107169884 CTCAGCAAAAAGAGCAAAGCAGG - Intergenic
1088524860 11:110741528-110741550 CTCAGAAAAATGGGCAGACTAGG - Intergenic
1089246434 11:117124079-117124101 CACACAAAAAAGAGCAGAGTTGG + Intergenic
1089442116 11:118526190-118526212 ATCAGAGAAAAATGCAGACATGG + Exonic
1089553856 11:119303827-119303849 CTCAGGAAAAAGTTCAAGGAAGG - Exonic
1089956878 11:122579497-122579519 CTCAGAAAAAAGTGAAATAATGG + Intergenic
1090834898 11:130447224-130447246 CCCAGAAAAGAGTGCAGAATGGG - Intergenic
1091403154 12:193112-193134 CCCAGAAAGAAGAGCAGGGAAGG + Intronic
1091765671 12:3118565-3118587 ATTAAAAAAAAGAGCAGAGAGGG - Intronic
1092574398 12:9763888-9763910 CCCATAAAAAAAAGCAGAGAAGG - Intergenic
1093032237 12:14298765-14298787 CTCAGACAAAGGTGGAAAGACGG + Intergenic
1093101978 12:15038489-15038511 CCCAGAAGAGGGTGCAGAGAGGG + Intergenic
1093749136 12:22778781-22778803 CAAAAAAAAAAGTGAAGAGAAGG - Intergenic
1093768448 12:22992433-22992455 ATAAGAATAAAGTGCAAAGAGGG - Intergenic
1094077024 12:26488468-26488490 CACAGAGAAAATTGCAGAGTAGG - Intronic
1094261741 12:28508320-28508342 TCCAGAAAAAAGAACAGAGAAGG - Intronic
1094753945 12:33444191-33444213 CCCAGAAAAAAAAACAGAGATGG - Intergenic
1095405563 12:41863410-41863432 CTGAGAAGAAAGAGAAGAGAAGG + Intergenic
1095645331 12:44538700-44538722 CTCGGGAAAAAGTGGAGACAAGG + Intronic
1096420028 12:51449135-51449157 CTCAGGAAAAACTGAAGTGAGGG + Intronic
1096966496 12:55632074-55632096 GGGAGAAAAAAGTCCAGAGACGG + Intergenic
1097295828 12:57961739-57961761 CTCAGCAAAATGGGCAGACAAGG + Intergenic
1097616001 12:61885281-61885303 GTCAGATAAAAGAGTAGAGAAGG + Intronic
1098860239 12:75701404-75701426 CTGAGAAAACAGTACACAGATGG - Intergenic
1099408895 12:82299681-82299703 CTTAGAAGAAATGGCAGAGAAGG + Intronic
1099576075 12:84383415-84383437 CTCAGAAAAATCAGCATAGATGG - Intergenic
1099860581 12:88220813-88220835 CTAAGAAAAAAGAACAGAGATGG + Intergenic
1102335266 12:112073435-112073457 CTCAAAAAAAAGTGAATAAATGG - Intronic
1102892385 12:116570129-116570151 CTCAGAAGAAGGGGCAAAGAGGG + Intergenic
1103841231 12:123866825-123866847 TTCTGTGAAAAGTGCAGAGATGG + Intronic
1104340179 12:127941905-127941927 CTTTGAAAAAAGTACACAGATGG - Intergenic
1105018325 12:132799640-132799662 CTCCGAAAAAACAGCAGATAGGG + Intronic
1105446418 13:20461610-20461632 CTCAGAACCAAGTGGAGAAACGG + Intronic
1105904214 13:24789045-24789067 CTAAGAAAATAGGGCAGAAAGGG + Intronic
1106975791 13:35212144-35212166 CTGGGAAAAAAGTGCAAAGTAGG - Intronic
1107066118 13:36215511-36215533 CTCAGTAAAATGTTCAGTGAAGG - Intronic
1107329253 13:39280710-39280732 CTCAGAAAAAAATGAAGAGAAGG + Intergenic
1107436604 13:40385927-40385949 CTCACAAAACAGTGCCGAGCAGG + Intergenic
1107596945 13:41973210-41973232 CTCAGGAAACTGCGCAGAGAAGG - Intergenic
1107651165 13:42546730-42546752 CTCAGTAAGGACTGCAGAGAGGG - Intergenic
1108420059 13:50239774-50239796 CTCAAAAAAAAGTGCTGACAGGG - Intronic
1108490458 13:50976305-50976327 CACAGTAAAGAGGGCAGAGATGG - Intergenic
1108809728 13:54206961-54206983 CTATGAAATAAGTACAGAGATGG - Intergenic
1109143343 13:58745044-58745066 CACAGAAAAAAGTACTAAGAGGG - Intergenic
1109222765 13:59657389-59657411 TTCAGAAAAAAGGGAAGAAAAGG + Intergenic
1109293623 13:60504370-60504392 CCCAGACAGAAGTGCAGATAAGG + Intronic
1109454286 13:62563909-62563931 CTTAGAAAACAGAGCAAAGAAGG + Intergenic
1109988562 13:70022237-70022259 CTTTGAAAAAAGAGCAAAGAGGG - Intronic
1110633291 13:77735415-77735437 CTCAGAAAAACGTGCAGGGCTGG - Intronic
1110756062 13:79175644-79175666 CTCAGCAAAATTGGCAGAGAAGG + Intergenic
1110964317 13:81673273-81673295 ATCAGAAAGAAGTGAAAAGAAGG - Intergenic
1111607684 13:90562008-90562030 CTCACAAAAAAGTGGATAAATGG + Intergenic
1112010844 13:95292779-95292801 CGCAGAGAAAAGAGCAGACAGGG + Intronic
1112123643 13:96440626-96440648 ATCACATAAAAGTGAAGAGAAGG + Intronic
1112156291 13:96820855-96820877 CTCAGAAAAGTGTTCAGAGAAGG - Intronic
1112615718 13:101003073-101003095 GACAGAAATAGGTGCAGAGAAGG - Intergenic
1112643136 13:101299917-101299939 TTAAGAAGAAAGTGCTGAGATGG - Intronic
1113074236 13:106452149-106452171 CACATAAAAAAGCACAGAGAGGG - Intergenic
1114054144 14:18952125-18952147 CTCAGCAAAAAATGCACAGAAGG - Intergenic
1114108412 14:19449807-19449829 CTCAGCAAAAAATGCACAGAAGG + Intergenic
1114167665 14:20236208-20236230 CTCAGATGAAAATGCAGAAATGG + Intergenic
1114214382 14:20644997-20645019 AGCAGAAAAAAGTGAAGACATGG - Intergenic
1114866603 14:26602057-26602079 CTCAGAAAAAGATGCAGTGCTGG - Intergenic
1114893321 14:26953176-26953198 CACAGAGAAAAGTGCATGGATGG + Intergenic
1115484878 14:33901087-33901109 CTCTCAACGAAGTGCAGAGAAGG + Intergenic
1115667357 14:35566199-35566221 GTAAGAAACAAGTGCAGCGAAGG + Intronic
1115772954 14:36685716-36685738 GTCAGAAAGCAGTGCAGGGAGGG - Intronic
1115806203 14:37054911-37054933 GTGAGAAAAAAATGCACAGAGGG + Intronic
1117049571 14:51846828-51846850 CTCACACAAAAGTGGAGGGAAGG - Intronic
1117229992 14:53707468-53707490 CACAGAAATAAATGCAGTGAAGG + Intergenic
1117435999 14:55715778-55715800 CACAGACAAAAGAGAAGAGATGG - Intergenic
1118906849 14:70029558-70029580 CTCAGAATAAAGAGCAGACTTGG - Intronic
1119790711 14:77347304-77347326 CTCAGGGATAACTGCAGAGAGGG - Intronic
1119978493 14:79052808-79052830 CCCAGAAAACACTGCAGATATGG - Intronic
1120450632 14:84662375-84662397 CTCAGAAAAATCAGCATAGAAGG - Intergenic
1121419037 14:93799366-93799388 CTCAGGCAGAAGAGCAGAGAAGG - Intergenic
1121767402 14:96499960-96499982 CTCAGAAGGCAGTGAAGAGAGGG - Intergenic
1121907951 14:97764737-97764759 TTCACAAAAAAGGGCTGAGAAGG + Intergenic
1122064172 14:99160093-99160115 CTGAGAAAGCAGGGCAGAGAGGG + Intergenic
1123414914 15:20088316-20088338 CTCAAAAAAAAATGCAGTAATGG - Intergenic
1123524256 15:21095430-21095452 CTCAAAAAAAAATGCAGTAATGG - Intergenic
1123673231 15:22681831-22681853 CTCAGTGAAGAGTGCAGAGCAGG - Intergenic
1124085998 15:26551301-26551323 TTGAGAAGAGAGTGCAGAGAGGG + Intronic
1124325289 15:28755123-28755145 CTCAGTGAAGAGTGCAGAGCAGG - Intergenic
1125366979 15:38927896-38927918 CTAAGCAAAAAGAGCAGAGCTGG - Intergenic
1125455066 15:39849713-39849735 CTCAGAAAAATGGGAAGAGAGGG + Intronic
1125633996 15:41171879-41171901 CTCAGAAGGAAGTGCTGAGGAGG + Intergenic
1126143404 15:45455335-45455357 CTGAGAAAAAGGTCCAGAGTTGG + Intergenic
1127090641 15:55463254-55463276 CTCAGCAAAATGGGCACAGAAGG + Intronic
1127373039 15:58358004-58358026 GTCACAAAAAAGTGCTGAGGTGG - Intronic
1127546296 15:59996914-59996936 CTGAGAAAAAAGGCGAGAGAAGG + Intergenic
1127665493 15:61142008-61142030 CTCTGAACAAAGTACAAAGAAGG + Intronic
1128080167 15:64852410-64852432 CTCAGAGAAAGGGGAAGAGATGG - Intronic
1128996738 15:72302790-72302812 GTCAGAGAAAAGAGGAGAGAGGG - Intronic
1129756537 15:78102476-78102498 CTCAGAACACAGCCCAGAGAGGG + Intronic
1130127428 15:81105416-81105438 CTCAGAAAAGAAAGAAGAGAAGG - Intronic
1130244947 15:82238461-82238483 CCTAGAAGAAAGAGCAGAGAGGG - Exonic
1130455681 15:84104643-84104665 CCTAGAAGAAAGAGCAGAGAGGG + Intergenic
1130993200 15:88889031-88889053 CTCAGAGAAGATGGCAGAGAGGG + Intronic
1131298375 15:91172511-91172533 CTCAGAACAGAGGGCACAGAGGG + Intronic
1131441212 15:92461087-92461109 CTCAGAGCAAAGTGGAGACATGG + Intronic
1132316937 15:100897311-100897333 CTCAGAGACCAGTGCAGACACGG - Intronic
1132327729 15:100985784-100985806 CTTTGCAGAAAGTGCAGAGATGG + Intronic
1132981575 16:2740892-2740914 CTGAGAAGAAAGTTCAGAGTAGG - Intergenic
1135288407 16:21213817-21213839 TTCAGAAAAATATGCATAGAAGG - Intronic
1135387373 16:22055091-22055113 CTCAAAAACAAATGGAGAGAAGG - Intronic
1137340223 16:47594612-47594634 CCCAGAAAAAACTCCAAAGAGGG - Intronic
1137586477 16:49666877-49666899 CCCAGAAAAAAGGGCAGGGTGGG + Intronic
1137906671 16:52330511-52330533 CTCAGAACAGAGTCCAGAGGTGG + Intergenic
1137968795 16:52962885-52962907 TTCAGGAAAAAGGGCAGTGAAGG - Intergenic
1138161195 16:54756419-54756441 CACAGAAAGAAGTGCAGACATGG - Intergenic
1138375522 16:56561196-56561218 GACAGAAAAAAGGGCAGAGGTGG + Intergenic
1138676493 16:58655226-58655248 CTGAGGAAAAAGGACAGAGAAGG + Intergenic
1139601451 16:67989941-67989963 CACTGAAAAAAATGCAGTGATGG - Intronic
1140211722 16:72975779-72975801 CTCAGCAAAAATGGCACAGATGG + Intronic
1140232863 16:73132282-73132304 CTCAAAAAAAAGAGTGGAGAGGG + Intronic
1140319455 16:73934691-73934713 CTAAGAAAAAAGAACAAAGATGG + Intergenic
1140374230 16:74431859-74431881 CACAGAAAAGGGTGCAGACATGG + Intergenic
1141231254 16:82169957-82169979 CCCAGTAAACAGTGCAGAGCAGG + Intronic
1141894352 16:86949100-86949122 CTCACAAAAAAGTGAAAAAATGG - Intergenic
1142491801 17:284452-284474 CTCAAAACAATGGGCAGAGAAGG + Intronic
1143014758 17:3885731-3885753 CTGAGAAAAGAAGGCAGAGAAGG + Intronic
1143877703 17:10004568-10004590 CCCAGAAAAAAAGGCAGAGTAGG + Intronic
1146414294 17:32617430-32617452 CTCAAAAAAAAGAGCAAAGCAGG - Intronic
1147539341 17:41343932-41343954 CTCAGAAAACAGTGCTCTGAGGG - Intergenic
1148716967 17:49722821-49722843 CTCAGAAAAGAGTAAAGAGGAGG - Intronic
1149430971 17:56595565-56595587 ATGAGAAAGAAGTGCAGAGCAGG + Exonic
1149893243 17:60408806-60408828 CTCAGACCAAGGAGCAGAGACGG + Intronic
1149986658 17:61352787-61352809 GTAAGAGAAAAGGGCAGAGATGG + Intronic
1150435222 17:65148656-65148678 TCCCAAAAAAAGTGCAGAGAGGG - Intronic
1151884699 17:76916640-76916662 CTCAGAAAGAAATGAGGAGAAGG + Intronic
1152213115 17:79014075-79014097 ACCAGACAAAAGTGCAGATAAGG - Intergenic
1153113376 18:1621770-1621792 CCCAGAAAGAAATGCAGAGTAGG + Intergenic
1153132657 18:1874710-1874732 CTGAGATATAAGTTCAGAGAAGG + Intergenic
1153512020 18:5865246-5865268 AGCAGACAAAAGTGCAGATAAGG - Intergenic
1153575791 18:6519547-6519569 CTCAGCAAAAAGAACAAAGATGG - Intronic
1153889502 18:9499640-9499662 CACAGAAAAAAGTACAGTTATGG - Intronic
1155411479 18:25550167-25550189 CTCATAAAAACATGCAGAGCAGG + Intergenic
1156196891 18:34784478-34784500 CACAGCAGAAAGTGCATAGATGG - Intronic
1156276441 18:35587801-35587823 CAGAGAAAACAGTGCTGAGAGGG - Intronic
1156415983 18:36890940-36890962 CTCATAAAGAAGAGCCGAGAAGG + Intronic
1156432915 18:37094851-37094873 CACAGAATAAAGTGAAGGGATGG + Intronic
1156939387 18:42746871-42746893 CTCAGAAAAATTGGCATAGAAGG + Intronic
1156947994 18:42858280-42858302 TTCATACAGAAGTGCAGAGATGG - Intronic
1157895537 18:51463415-51463437 TTAAGAAAAAAGTGCACAAATGG - Intergenic
1157976644 18:52335501-52335523 CTCAGAAAAAAATGCAAAATGGG - Intergenic
1158808433 18:61002885-61002907 GGCAGAAAAATGTGAAGAGAGGG - Intergenic
1158939627 18:62395123-62395145 CTGAGAACAAGGTGCACAGAGGG - Intergenic
1159291476 18:66428164-66428186 CTCAAAAAAAAGGGAAGAAAGGG - Intergenic
1159387113 18:67740917-67740939 ATCAGAAAATACTGCAGAGAAGG - Intergenic
1160600443 18:80008607-80008629 CTCAGGTAAAAGTACAAAGAGGG - Intronic
1161327182 19:3669557-3669579 GCCAGCAAAGAGTGCAGAGAAGG + Intronic
1162818687 19:13210314-13210336 CCCAGAAAGAGGTGCAGAGTGGG + Intronic
1163901428 19:20104044-20104066 CTGAGAAAAAAGAGCAGAATAGG - Intronic
1163930678 19:20387920-20387942 CTGAGAAGAAATTCCAGAGAAGG + Intergenic
1163959469 19:20675004-20675026 CTGAGAATAAATTCCAGAGAAGG + Intronic
1164552385 19:29222345-29222367 TTCACACAAAAGTGCTGAGAAGG - Intergenic
1164874004 19:31670480-31670502 CTATGAATAGAGTGCAGAGATGG + Intergenic
1168067511 19:53926910-53926932 CTCAGAAAAAAGAAGAGTGAGGG + Intronic
924959834 2:24407-24429 CTCAGAAAAAAGTGTTCATAGGG - Intergenic
925811727 2:7707994-7708016 ATCAGAAACAAGTGTAGATAGGG + Intergenic
926149507 2:10416893-10416915 CTCAGAACAATGTGCAGATAGGG - Intronic
926282707 2:11463616-11463638 CTAAGAAGAATGTGTAGAGACGG + Intronic
926930320 2:18031543-18031565 GGAAGGAAAAAGTGCAGAGAGGG - Intronic
927624096 2:24694999-24695021 CACAGAAAAAATGTCAGAGATGG + Intronic
929087494 2:38182908-38182930 CTCAGAACTCAGAGCAGAGAAGG - Intergenic
929197405 2:39199806-39199828 CTCAGAAAAATCAGCACAGAAGG + Intronic
929736063 2:44550666-44550688 TTCAGAAAAGAGTGGATAGATGG - Intronic
929758654 2:44788289-44788311 CTCAGAAAAGAGGGTAGAGATGG - Intergenic
930018190 2:46985040-46985062 CTCAGCACAGAGTGCAGACAGGG - Intronic
930153507 2:48081419-48081441 CTCAGTAAGAAGTGCAGGCAAGG - Intergenic
930158731 2:48131425-48131447 CTCAGAGCAAAGTGCAGAATTGG + Intergenic
930469849 2:51798661-51798683 CTCAGCAAAATGAGCATAGAAGG + Intergenic
930858534 2:56044681-56044703 CTCAAAAAAAGATGCACAGAAGG - Intergenic
931068159 2:58611403-58611425 CTCCAGAAAAAGTTCAGAGATGG + Intergenic
931143906 2:59495180-59495202 CTCAGAAAAAAGAGCAAAGCTGG - Intergenic
931942635 2:67269543-67269565 TTCTGAAAAAAGAGCAGAGAGGG - Intergenic
932211188 2:69932111-69932133 CTGAGAAAAGAGAGCTGAGACGG + Intronic
932497283 2:72152339-72152361 CTCAGAAAACACTGCATACAGGG + Intergenic
932551032 2:72769239-72769261 CTCAGAATGAAGCACAGAGATGG + Intronic
932884552 2:75537282-75537304 CTCAGAAAAATATGAATAGAGGG + Intronic
933551207 2:83778488-83778510 CTCCCAAAAAATTGAAGAGAAGG - Intergenic
935307494 2:101751476-101751498 CTCAGACAAAAGGCCAGAGGGGG + Intronic
935528361 2:104200829-104200851 CTGAGGAAAAAGAGAAGAGAAGG + Intergenic
935681847 2:105645114-105645136 CTCAGAATAAAGTACAGGGAGGG - Intergenic
935730856 2:106064233-106064255 CAAAGAAAAAAGTGCAAAGTGGG - Intronic
936266870 2:111017574-111017596 CAGAGAAAGAAGTGCAGAGAAGG + Intronic
937256450 2:120559334-120559356 CTCAGGAAACAGTGCAGGGTTGG + Intergenic
937445481 2:121954336-121954358 CTCAGCAAAAAGTACAAAGCTGG - Intergenic
937689077 2:124734073-124734095 CTCAGAAAAGCATGCAGAGCTGG + Intronic
937725495 2:125159948-125159970 CTAAAAAAAAATTGCAGAGGAGG + Intergenic
937856994 2:126679575-126679597 CTCAAAAATTAGTGCAGAGTTGG + Intronic
937858731 2:126691629-126691651 CCCAGAAAACAGGGCAGAGCTGG - Intronic
937859237 2:126695216-126695238 CCCAGAAAACAGGGCAGAGCTGG - Intronic
938040745 2:128074005-128074027 CCCAAAAAAATGTGCATAGAGGG + Intergenic
938113482 2:128587490-128587512 CACAGAACAGAGTGCTGAGAGGG - Intergenic
939118301 2:138086989-138087011 CTAAGGAAAAAATGGAGAGAGGG + Intergenic
939120983 2:138116148-138116170 TCCAGAATAGAGTGCAGAGAGGG - Intergenic
939897905 2:147814170-147814192 CTGAGAAAAAGCAGCAGAGAGGG + Intergenic
940219726 2:151339377-151339399 GTCAGAAAAAGGTGCACAGCAGG - Intergenic
941348704 2:164404105-164404127 GTCAGAACAAAGTGCTCAGAGGG + Intergenic
941999410 2:171631153-171631175 CTCATAAAAACTTGCAGAGCAGG - Intergenic
942149877 2:173064724-173064746 ATCAGAAAGAAGTGGAGAGCAGG - Intergenic
942996468 2:182266906-182266928 ATCAGAAACAAGTCCAGAGATGG - Intronic
943354780 2:186839309-186839331 CTCTGAAAAAAATGTAAAGAAGG - Intronic
943969330 2:194383440-194383462 CACAGACAGAAGTGCAGATAAGG + Intergenic
944078656 2:195759845-195759867 CTTAAAAAAAATTGTAGAGATGG + Intronic
944111055 2:196131579-196131601 CTCTGAACAAAGGACAGAGAGGG + Intergenic
944383263 2:199136522-199136544 CACAGAAAAAAATGGAGAAATGG + Intergenic
944856375 2:203771275-203771297 CACAGAAAAAAATGGATAGAAGG - Intergenic
944926899 2:204474683-204474705 CTCAGAAGTAAGTGGAGAGGAGG - Intergenic
945286058 2:208083167-208083189 CTCAGCAAAATCAGCAGAGAAGG + Intergenic
945612639 2:212024067-212024089 CTGAGAGAAAAGGGGAGAGAAGG - Intronic
947143773 2:227044698-227044720 CTCTGAATAGAGTGCAGAGTAGG + Intronic
948267179 2:236643509-236643531 CTCAGAAAGAAGGGCCCAGAAGG - Intergenic
948649750 2:239434303-239434325 CTGAGAAAAGAGTGCACAGTCGG - Intergenic
1168977273 20:1976563-1976585 CTCACAAAATAGTGGTGAGAGGG + Intergenic
1169896930 20:10514121-10514143 TTCAAAGAAAAGTGCAAAGAAGG + Intronic
1169919603 20:10720651-10720673 CTGAGAAAGAAGTGAACAGAAGG + Intergenic
1170375022 20:15690798-15690820 CTCAGGGAAAAGAGGAGAGATGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171332356 20:24351530-24351552 GTCAGAACAAAATGCACAGAAGG + Intergenic
1171855425 20:30338579-30338601 ATCAGAAAAAAGGACAGAGGAGG - Intergenic
1171967910 20:31544260-31544282 CTCTGAAAAAAGTCCAGAAAAGG + Intronic
1172160164 20:32862437-32862459 TTCAGAAAAAGGAGCAAAGAGGG - Intronic
1173043031 20:39482871-39482893 CTTAGACAGAAGTGCAGATAAGG - Intergenic
1173707828 20:45125461-45125483 CTCAGGAAAAAGTTTAGTGAAGG - Intergenic
1175533811 20:59693293-59693315 CCCAGAACAAAGAGAAGAGAAGG - Intronic
1175548984 20:59803936-59803958 CTGAGAAACAGGTGCAGGGACGG - Intronic
1175562895 20:59946885-59946907 CTCACAAAAAAGGGCAGGCAAGG - Exonic
1176852150 21:13928674-13928696 CTCAAGAAAAAGGTCAGAGATGG - Intergenic
1176907432 21:14519837-14519859 CTAATAAAATAGTACAGAGAAGG - Intronic
1177320652 21:19515407-19515429 CTCAGCAAAAAGGGCAAAGCTGG + Intergenic
1177752631 21:25304369-25304391 CTCAAAGAAAAATACAGAGAAGG + Intergenic
1178088750 21:29139583-29139605 CTCAAAAAAAAAAGAAGAGAGGG - Intronic
1178226843 21:30729361-30729383 CTCAGCAAAAAGAACAAAGATGG + Intergenic
1178239175 21:30879729-30879751 TTCAGAAAGATGTGCAGGGAAGG - Intergenic
1179039792 21:37792381-37792403 CACAGAAATAAATGCAGAGAGGG - Intronic
1179362730 21:40727755-40727777 CTCAGAACAGAGGCCAGAGATGG - Intronic
1180472615 22:15674504-15674526 CTCAGCAAAAAATGCACAGAAGG - Intergenic
1181481207 22:23200266-23200288 CTCTGAAAAAAGTGCAGTCAGGG - Intronic
1181544869 22:23596513-23596535 CTCAGAAGAAAATGCAGAGCGGG - Intergenic
1181674686 22:24444105-24444127 CTCAGAAAAGGCTGGAGAGACGG - Intergenic
1181815440 22:25433359-25433381 CTCAGAAGAAAATGTAGAGTGGG + Intergenic
1182206445 22:28632823-28632845 CTCATAAAGAATTGCAGAGTAGG + Intronic
1184462420 22:44646740-44646762 CTCAGCTGACAGTGCAGAGAAGG + Intergenic
1185102303 22:48847794-48847816 CTCAGAAACCAGCACAGAGATGG + Intronic
1185106819 22:48875701-48875723 CTCAGCAAAAAATGTAGAGCCGG + Intergenic
1185109658 22:48893933-48893955 CTCAGAAGAGAGTGCAGCCATGG - Intergenic
949177713 3:1086188-1086210 CTCAGGAAAAAGTGCATTGAAGG - Intergenic
950031051 3:9853856-9853878 ATCAGATAACAGTGGAGAGAAGG + Intronic
950283247 3:11724768-11724790 ATGAAAAAAAAGTGCAGAGTAGG + Intergenic
950851368 3:16064903-16064925 CCCAGCAAAAAGGGCAGAGCAGG - Intergenic
951033978 3:17912856-17912878 ATCAGAAAAAAAAGCAAAGAAGG - Intronic
951118884 3:18899729-18899751 CTGCCAAAAAAATGCAGAGATGG + Intergenic
951198470 3:19851354-19851376 CTCAGCAAAATCAGCAGAGAAGG + Intergenic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
951731900 3:25819040-25819062 TTCAGTGAAAAATGCAGAGAAGG + Intergenic
952272779 3:31848932-31848954 CTTAGCAAAAAGTTCAGAGTTGG + Intronic
952868846 3:37879250-37879272 CTTAGAAAATAATGTAGAGATGG + Intronic
953088028 3:39692580-39692602 TTCAGAAAAACTTGAAGAGAAGG + Intergenic
953772271 3:45787039-45787061 CTGAGAACAAACTGCAGGGAGGG - Intronic
954360847 3:50122036-50122058 GTCAGAAAGAATTGCTGAGAGGG - Intergenic
954527361 3:51283880-51283902 CTCCTGAAACAGTGCAGAGAAGG + Intronic
954938925 3:54353267-54353289 CTCTGAAAGAAATGCAGAGATGG + Intronic
955554959 3:60126957-60126979 CACAGGAAAAATGGCAGAGATGG - Intronic
955878174 3:63515619-63515641 CTGAGAAAAAAGAACAGGGAAGG + Intronic
955883042 3:63568089-63568111 CTTAGAAAAAAGTGCAGTTGAGG + Intronic
956635560 3:71360907-71360929 CTCAGAAGAGAGTTAAGAGATGG + Intronic
956689143 3:71860055-71860077 CTCATAAAAAGATGAAGAGAGGG - Intergenic
956753255 3:72361883-72361905 GACAGAAAAAAATGAAGAGAAGG + Intergenic
958568889 3:95853924-95853946 CTCAGAAGAATGTGAAGTGAAGG + Intergenic
958772240 3:98438557-98438579 TTTACAAAAAAGTGCACAGATGG + Intergenic
958968382 3:100584611-100584633 ATCAGACAGAAGTGCAGACAAGG + Intergenic
959009426 3:101057731-101057753 CTCAGCAAAATTGGCAGAGAAGG - Intergenic
959185290 3:103039026-103039048 TTCATAAAAATGTGCAGAGGAGG + Intergenic
959362223 3:105407539-105407561 CTCAGCAAAATTGGCAGAGAAGG + Intronic
959366841 3:105471390-105471412 CCCACAAAAAAGTGCACAAATGG + Intronic
959698914 3:109279725-109279747 CTCAGTAAAACGTGTAGAAAAGG - Intergenic
959721980 3:109502027-109502049 CTCAGCAAAATTTGCATAGAAGG - Intergenic
959850607 3:111082395-111082417 AGAAGAAAAAAGTGGAGAGAGGG + Intronic
960196950 3:114780487-114780509 CTCAAAAAAAAGAAAAGAGAAGG - Intronic
960317330 3:116194240-116194262 CTCAGATAGAAATGCAGAGAAGG + Intronic
960514819 3:118591688-118591710 CCCAGACAGAAGTGCAGATAAGG - Intergenic
960756774 3:121022728-121022750 CTCAGTAAAATTGGCAGAGAAGG + Intronic
960925523 3:122792326-122792348 GTCAGAAAAAAGTGCAGGAAGGG + Intronic
961864823 3:129945923-129945945 CTTAGAAAGAAGTGTTGAGATGG - Intergenic
962849420 3:139296940-139296962 CAGAGGAAAAAGTGCAGTGAGGG - Intronic
963246746 3:143071078-143071100 CTCAGGCAAAACTGCAGGGAAGG - Intergenic
963354059 3:144188166-144188188 CTGAGAAAAAACTGCTGAGCTGG - Intergenic
963628570 3:147705045-147705067 CAAAGAAGAAAGTTCAGAGAGGG - Intergenic
963790577 3:149578425-149578447 CTCAGCAGTGAGTGCAGAGAAGG + Intronic
963958182 3:151278765-151278787 CACAGTATAACGTGCAGAGATGG + Intronic
964009645 3:151876165-151876187 CTCAGAAATAAGGCCTGAGAAGG + Intronic
964038939 3:152235192-152235214 GTCAGAAAAAAGTCCCAAGAGGG - Intergenic
964961690 3:162435795-162435817 CCCAGACAGAAGTGCAGATAAGG + Intergenic
965186330 3:165469195-165469217 CTCAGAAAACAATGCTAAGAGGG - Intergenic
965869198 3:173246429-173246451 ATCAGACAGAAGTGCAGACAAGG + Intergenic
965902804 3:173664338-173664360 CTCAGTAAAAAGATAAGAGATGG - Intronic
965985355 3:174746631-174746653 CTAAGAAAAAAGAACAGAGATGG + Intronic
966134439 3:176682478-176682500 CTTTGAGAAAAGTGCAGTGAAGG - Intergenic
966234210 3:177682711-177682733 CCCAAAAAAAAGTACAGGGAGGG - Intergenic
967977590 3:195044191-195044213 CACAGAAAACAGAGCAGAGAAGG - Intergenic
968113291 3:196067923-196067945 CCCAGAAAAAAGAGCAGTTAAGG + Intronic
969343300 4:6555959-6555981 CACACAAAATAGGGCAGAGATGG - Intronic
969368540 4:6715559-6715581 CTCAAAAAAAAAAGCAAAGACGG - Intergenic
970478213 4:16446440-16446462 CATAAAAAAAAGTGCAGAAAAGG - Intergenic
972409091 4:38774062-38774084 CTCTGAACAAAATCCAGAGATGG + Exonic
973667039 4:53171537-53171559 CTTTGAAAAAATTGTAGAGAAGG - Intronic
974317271 4:60298504-60298526 TTCAGAAAGAAGTTCAGGGAAGG + Intergenic
974679645 4:65145030-65145052 CCTAGAATAAAGAGCAGAGAGGG - Intergenic
974730399 4:65857194-65857216 CTAAGCAAAAAGTGCAAAGCTGG - Intergenic
975271441 4:72438826-72438848 CTCAAAATGTAGTGCAGAGAGGG - Intronic
975364607 4:73514647-73514669 CTCAGAAAAATTAGCACAGAAGG - Intergenic
975987095 4:80210768-80210790 CTCAGAGAAAAGTGCAATCATGG - Intergenic
976224736 4:82786936-82786958 GTCAGAAAAATGTGTAGAGCGGG - Intronic
976391357 4:84507859-84507881 CACAAACAAAAGTGCAAAGAAGG - Intergenic
977094228 4:92718591-92718613 TTAAAAAAAAATTGCAGAGACGG - Intronic
977141042 4:93372525-93372547 CCCAGAAAAAAGAGAAAAGAAGG - Intronic
977232475 4:94468150-94468172 CAAAAAAAAAAGTGCATAGAGGG - Intronic
977592969 4:98847673-98847695 ATCAGACAGAAGTGCAGATAAGG + Intergenic
977641428 4:99361879-99361901 GACAGTAAAAAGTGAAGAGATGG + Intergenic
978286146 4:107079415-107079437 CACTGAAATAATTGCAGAGAGGG - Intronic
978356690 4:107883179-107883201 TACAGAAAAAGGTGCAGGGATGG - Intronic
978443899 4:108762805-108762827 CCCGGAAGTAAGTGCAGAGAGGG - Intronic
978977960 4:114903069-114903091 ATCAGAACAAGGTTCAGAGATGG - Intronic
979095821 4:116549456-116549478 ATCAGAGAAAAATTCAGAGAAGG - Intergenic
979097368 4:116567744-116567766 CTAAGCAAAAAGAGCAAAGATGG + Intergenic
979198226 4:117945143-117945165 CTAAGACAAAAGAACAGAGATGG + Intergenic
979575514 4:122287030-122287052 CTATGAAAATATTGCAGAGATGG - Intronic
979795397 4:124839843-124839865 CTCATAAAAACTTGCAGAGCAGG - Intergenic
980642684 4:135599931-135599953 CTCAGAAAGAAGTGAAGATAAGG - Intergenic
981338897 4:143597506-143597528 CTGAGAAAGAAGAGCAGAGCTGG - Intronic
981531677 4:145760464-145760486 TTCAGAGAAAAGTACGGAGAAGG + Intronic
981564850 4:146089239-146089261 CTCAGAAAAAAGGCCATATAAGG - Intergenic
982574230 4:157088717-157088739 CTCAGAAGACAGTGGGGAGATGG - Intronic
983528784 4:168788246-168788268 CTTAGAAAAATGTGTAGAAAAGG + Intronic
983533711 4:168835462-168835484 TTGAGAAAAAGCTGCAGAGAAGG + Intronic
984590363 4:181610654-181610676 CTCATAAATAACTTCAGAGAAGG + Intergenic
984902546 4:184598040-184598062 CTCATTAAAAAGTGTAGACAGGG - Intergenic
985313054 4:188624782-188624804 TTCAGAATAAAGTGCAGTTATGG + Intergenic
985326101 4:188772346-188772368 CTTAGCAAAATGAGCAGAGAAGG - Intergenic
985901140 5:2794542-2794564 CTCAAAAAAAAGCACAGAGATGG - Intergenic
986227844 5:5833388-5833410 CTCATAAAAAAGTGGACAAATGG + Intergenic
986346899 5:6844146-6844168 GTCAGAGAAGTGTGCAGAGACGG - Intergenic
986483504 5:8212914-8212936 GTCAGGAAAAAGATCAGAGAAGG - Intergenic
986973174 5:13361043-13361065 TTCAAAAAACAGTGCAGGGAGGG + Intergenic
987216780 5:15745803-15745825 TACAGAACACAGTGCAGAGATGG - Intronic
987690182 5:21256157-21256179 TTGAGAAAAAAATGCAGGGATGG - Intergenic
987886147 5:23815625-23815647 CTCATAGAAAAGTACAGAGCAGG + Intergenic
988155489 5:27444234-27444256 CTCAAAAAAATGGGCATAGAAGG + Intergenic
988191174 5:27936968-27936990 GTGAGACAAAAGTGCAGAAAGGG + Intergenic
989832440 5:45937446-45937468 CTCAGAAAAAAATAGAAAGAAGG + Intergenic
990276368 5:54201416-54201438 TTCACAAAGAAGTGCACAGATGG - Intronic
990834563 5:60002374-60002396 TTCCAAAAAAAGTGAAGAGAAGG + Intronic
992710480 5:79448994-79449016 CTCAGAGAAAAGTTCAAACAAGG + Intronic
993155082 5:84212286-84212308 CACAGATAAAAGTGGAGAGAAGG + Intronic
993549566 5:89256925-89256947 CTGAGGAAAAAGTTAAGAGAAGG + Intergenic
993775257 5:91986784-91986806 CTCAAACAAACCTGCAGAGAGGG - Intergenic
993948252 5:94140716-94140738 CTCAGAAAAATCAGCATAGAAGG - Intergenic
993980790 5:94541229-94541251 CCCAGACAGAAGTGCAGATAAGG - Intronic
994441070 5:99803417-99803439 CTCAGCAAAAAGTACAAAGCTGG + Intergenic
994662513 5:102670754-102670776 TTGAAAAAAAATTGCAGAGAAGG - Intergenic
995484351 5:112624787-112624809 CTGAGCAAAAAGAACAGAGATGG + Intergenic
995709187 5:115017564-115017586 CTCAGAAAAAAGCTCTGAAATGG - Intergenic
995756271 5:115507845-115507867 CTGAGAATAAAATGCAGTGAAGG - Intergenic
996167596 5:120244414-120244436 CTCAGAAAATCCTGCACAGATGG + Intergenic
997103333 5:130992500-130992522 TAGAGAAAAAAATGCAGAGATGG + Intergenic
997244333 5:132333680-132333702 CTAAGTAGAAAGTGCAGAAAAGG + Intronic
997488237 5:134250012-134250034 TTCAAAAAGAAGTGTAGAGAGGG - Intergenic
997618592 5:135270435-135270457 CAAAGAAATAAGTGCAGAAAGGG - Intronic
998324675 5:141269367-141269389 CTCAGCAAAAAGATCAGAGAAGG - Intergenic
998420216 5:141978445-141978467 CTCAGAAAAAAGTGCAGAGAAGG + Exonic
998703074 5:144727468-144727490 CTCAGCAAAATCTGCATAGAAGG - Intergenic
998976455 5:147654152-147654174 CTAAGCAAAAAGAGCAGAGCTGG - Intronic
999657331 5:153823660-153823682 CATATAAAAAAGTGAAGAGAAGG + Intergenic
999660166 5:153853173-153853195 CTCTGAAAAAATTGAAGAGGAGG - Intergenic
999969342 5:156843579-156843601 CTAAGAAAAAGGGGGAGAGAGGG + Intergenic
1000061159 5:157656536-157656558 CACAGACAGAAGTGCAGATAAGG - Intronic
1000213816 5:159136108-159136130 CTAAGGAAAGAGGGCAGAGAGGG - Intergenic
1000213993 5:159137503-159137525 CTAAGGAAAGAGGGCAGAGAGGG - Intergenic
1000241434 5:159412153-159412175 CTCAGAAAATAATTCAAAGATGG + Intergenic
1001452822 5:171839329-171839351 CACAGAAAAAAACACAGAGATGG - Intergenic
1002133653 5:177095805-177095827 GTCATGAAAAAGAGCAGAGAGGG - Intronic
1002834810 6:857143-857165 CTAAGAAAAAAATGCAGCGATGG - Intergenic
1002999969 6:2322623-2322645 TTCCAAAAAAAGTGAAGAGAAGG - Intergenic
1003014257 6:2455353-2455375 CTCAGAGAAAAGTGTTAAGATGG + Intergenic
1003214933 6:4100450-4100472 CACTGAAAAAAATGCAGACAAGG - Intronic
1003293675 6:4804910-4804932 CTCAGATAAAAGTATAGAAATGG - Intronic
1003648767 6:7938672-7938694 GTGTTAAAAAAGTGCAGAGAGGG - Intronic
1004024281 6:11804108-11804130 CTCAAAGAAAAATGCAGAAAGGG - Intronic
1004557142 6:16710030-16710052 CTTAGAAAAAAGAGAATAGAAGG + Intronic
1005181408 6:23111471-23111493 CCCAGACAGAAGTGCAGATAAGG + Intergenic
1005559227 6:27020680-27020702 CTAAGAACAAAGTGGAAAGAAGG - Intergenic
1005952676 6:30643169-30643191 CTGGGAAAAAAATGCAGTGAAGG + Intronic
1006167914 6:32076151-32076173 CATGGAAAGAAGTGCAGAGAGGG - Intronic
1006712035 6:36082798-36082820 CTCAGAAAACTGTGAACAGAAGG - Intronic
1007325351 6:41055283-41055305 CTCAGAAAAAGGGGCACAGAAGG + Intronic
1008147906 6:47913829-47913851 CACAGAAAAATGTTTAGAGAAGG - Intronic
1008258664 6:49337094-49337116 CTCATAAAAACTTGCAGAGCAGG + Intergenic
1008469326 6:51865602-51865624 CTCAGTAAGAGGTCCAGAGAGGG - Intronic
1009266719 6:61564842-61564864 CTCAGCAAAAAGAACAAAGATGG + Intergenic
1009735392 6:67670292-67670314 CTCAGAAGAAAGAGAAGGGATGG - Intergenic
1010175829 6:73026975-73026997 CTCAGAACAAAGTGCAGAAAAGG - Intronic
1010410820 6:75559568-75559590 CTTAGAAAAAAGGCCAGACATGG + Intergenic
1010480704 6:76349562-76349584 CTCAAAAAGAAGCTCAGAGAGGG - Intergenic
1010901228 6:81430790-81430812 CTCAGACAACAGTGCAGTAAAGG - Intergenic
1010903994 6:81463272-81463294 CTCAGAAAAATTGGCATAGAAGG + Intergenic
1010946419 6:81979253-81979275 CACAGAGAAAAGTGAGGAGAAGG - Intergenic
1011005556 6:82641066-82641088 CTCAGAAAAATCTGTATAGAAGG + Intergenic
1011378476 6:86717680-86717702 CTCACAATAAATTGCAGAGAAGG + Intergenic
1011787615 6:90864504-90864526 CTCAGAATAGGGTGCAGAGAAGG + Intergenic
1012380089 6:98610418-98610440 CACTGAAAAAAATGCAGAGATGG + Intergenic
1012692810 6:102336014-102336036 CTAATAAAAATGTGAAGAGAGGG + Intergenic
1013050658 6:106531691-106531713 CCTAGAAAAAAGTTCACAGAAGG + Intronic
1013381554 6:109577161-109577183 CTCAGAAAAATGGGCATAAAAGG - Intronic
1013627371 6:111951269-111951291 CTCAGAAACATCTGGAGAGAAGG - Intergenic
1013691286 6:112647851-112647873 CTCAGAAAAATCTCCTGAGATGG + Intergenic
1013743840 6:113321062-113321084 ATTAGAATAAAATGCAGAGAGGG - Intergenic
1013876949 6:114843390-114843412 CTCAGCAAAAAGAGCAAAGCTGG + Intergenic
1013961520 6:115906702-115906724 CTCAGAAAAAGGTACAAAAATGG - Intergenic
1014144576 6:117982709-117982731 CTCAGAAGAGAGTGCAGTTAAGG + Intronic
1014163144 6:118193722-118193744 ATCAGACAGAAGTGCAGATAGGG + Intronic
1014769745 6:125447085-125447107 CTCAGTGAGAAGAGCAGAGAGGG - Intergenic
1015772947 6:136787501-136787523 CTCAGAAAAGAGTGGAGTGTTGG - Intronic
1017348596 6:153413910-153413932 CCCAGACAGAAGTGCAGATAAGG + Intergenic
1017544073 6:155432648-155432670 CCCAGGAAAAAAAGCAGAGAGGG - Intronic
1018357443 6:163033280-163033302 CCCAGACAGAAGTGCAGATAAGG + Intronic
1018894556 6:168004700-168004722 CTCAGGAGAAAGTGCTTAGAGGG - Intronic
1019937741 7:4267345-4267367 CTCAGAAAAAGGAGGAGAAAAGG - Exonic
1020533566 7:9364877-9364899 CTCAGGAAAAGGAGCAGGGAGGG - Intergenic
1020534975 7:9386056-9386078 AACAGAAAAAAGTTCAAAGAAGG - Intergenic
1020995759 7:15261963-15261985 CTCAGAAAAACCAGCATAGAAGG + Intronic
1021079577 7:16347971-16347993 CTCTGAGAGCAGTGCAGAGAAGG + Intronic
1021383294 7:19995326-19995348 CCCAGTAAAAAGTGCACAAAGGG - Intergenic
1021440898 7:20674445-20674467 CTCAGAAAAAAATGCAAGAAAGG - Intronic
1022792242 7:33700651-33700673 CTCTGAAGAAAGTGCAAAGAGGG - Intergenic
1023144733 7:37139043-37139065 CTCAGCAAAATCTGCATAGAAGG + Intronic
1023693081 7:42812422-42812444 CTCAGCAAAAACTGCAGGCAAGG + Intergenic
1023915254 7:44583604-44583626 TTCAAAAAAAAATGCAGAAAGGG - Intergenic
1023927991 7:44684350-44684372 CTCAGCAAGAAGTAGAGAGAGGG + Intronic
1023933471 7:44722285-44722307 CTCAGACAGAAGTCCAGATAAGG + Intergenic
1024550787 7:50561143-50561165 CTCAGTAAATAATGCAGAGCCGG - Intronic
1024729284 7:52236269-52236291 TTCTGAGAAAAGTGCAAAGAGGG + Intergenic
1027750333 7:82136389-82136411 GTCTGGAAAAAGTGCAGTGAGGG + Intronic
1028002292 7:85514468-85514490 GTAATCAAAAAGTGCAGAGAGGG - Intergenic
1028525892 7:91786247-91786269 ATGAAAACAAAGTGCAGAGAGGG - Intronic
1028639824 7:93029581-93029603 CGCAGAAAAATGTGAAAAGAGGG + Intergenic
1029099244 7:98114707-98114729 CTCTGAAAAAAGTGCTGTGGAGG - Intronic
1029222199 7:98999459-98999481 CTCAGGAAAAAGTGCCGAGAAGG - Intronic
1030312603 7:108083420-108083442 CTCAGAAAAGAGTGCTGCCAAGG - Intronic
1030389195 7:108904663-108904685 CCCAGAATAAAGTGTAGGGAAGG - Intergenic
1031329794 7:120450490-120450512 CTCAGGAAAACTAGCAGAGAAGG + Intronic
1031385694 7:121148242-121148264 CTCAGAACAAAGTGCATAGTGGG - Intronic
1031639673 7:124145852-124145874 CTCAGAAGAAACAGGAGAGATGG - Intergenic
1032727807 7:134607327-134607349 CTCAGAAAGGAGTGAAAAGAAGG - Intergenic
1032941095 7:136793096-136793118 CTCAGAAAACTGTGGATAGAAGG + Intergenic
1033017675 7:137688490-137688512 GTCACACAAAAGGGCAGAGAAGG + Intronic
1033323153 7:140358268-140358290 CTCTCAAAAAAGGGCAGGGAAGG + Intronic
1033628269 7:143132235-143132257 CACAAAAAAAATTGCAGGGAGGG + Intronic
1033792729 7:144811536-144811558 CTCTGATAAAAGGGCAGTGAAGG - Intronic
1034683388 7:152948334-152948356 GGGAGAAAAGAGTGCAGAGAAGG - Intergenic
1035031856 7:155865974-155865996 TTCAGGCAAAAGAGCAGAGAGGG + Intergenic
1035589063 8:799241-799263 CTCAGAAAACAGAGCTGTGACGG - Intergenic
1037018252 8:13935286-13935308 CTGAGAAAGAAGTACAGAAAAGG - Intergenic
1037265872 8:17059606-17059628 CTGAGAAAAAAGTTTAGTGAAGG + Intronic
1037330727 8:17741178-17741200 CTTAGAAAAAGATGAAGAGATGG - Intronic
1037375937 8:18228237-18228259 TTCAGAAAAAAATGAAGAGAAGG + Intergenic
1037835054 8:22210764-22210786 TTCAGAAGAAAGAGCAAAGAGGG - Intronic
1038008442 8:23454543-23454565 CTCAGAGAAGAGCACAGAGAAGG + Intronic
1038629223 8:29225021-29225043 CAAGGAAAAAAGTGGAGAGAAGG + Intronic
1038909064 8:31941366-31941388 CTCAGCAAAATCTGCATAGAAGG + Intronic
1039183865 8:34895154-34895176 CCCAGACAGAAGTGCAGATAAGG - Intergenic
1039642939 8:39243598-39243620 CTCAGAAAAATTGGCATAGAAGG + Intronic
1039716367 8:40113839-40113861 CGCAGAAAAGACTGCAGAGAAGG - Intergenic
1039740357 8:40377277-40377299 CTGAGAAAAGAGTGCTCAGATGG + Intergenic
1040351047 8:46568727-46568749 CTCAGAAAGAGTTGCAGAGGGGG - Intergenic
1040365948 8:46715984-46716006 CTCAGAAAGAGTTGCAGAGGGGG + Intergenic
1040541441 8:48360494-48360516 CTAAGAAAAAATTGCATGGATGG + Intergenic
1040867710 8:52066767-52066789 CTCAGGAAAATCTGCATAGAAGG - Intergenic
1041147635 8:54894636-54894658 TTCTGAAAAAATTGCAGAGCTGG - Intergenic
1041757623 8:61331616-61331638 CTATGTGAAAAGTGCAGAGAAGG - Intronic
1042053231 8:64733798-64733820 CTAAAAAAAAATTGTAGAGATGG - Intronic
1042160889 8:65893910-65893932 CTCAGCAAAATCGGCAGAGAAGG + Intergenic
1042432222 8:68720905-68720927 TTCTGAAAAAAGTTCAGAGAGGG - Intronic
1043104108 8:76086205-76086227 CTCAGAAAAATCAGCATAGAAGG - Intergenic
1043557146 8:81444554-81444576 CACTGAATCAAGTGCAGAGATGG - Exonic
1043642159 8:82467906-82467928 CTCAGCAAAATTTGCATAGAAGG + Intergenic
1043988204 8:86718989-86719011 CTCAGAAAAACTGGCATAGAAGG + Intronic
1044439480 8:92206947-92206969 ATCAGACAGAAGTGCAGATAAGG + Intergenic
1045972114 8:108090802-108090824 TACAGAAAAAAGTTCAGAGGAGG - Intergenic
1046090501 8:109497811-109497833 CTCAGAAAAAACTTCATAGAGGG - Intronic
1047050442 8:121105689-121105711 CTCACAAAATTGTGTAGAGAGGG - Intergenic
1047569711 8:126084562-126084584 CTCAGAAGATGGTGTAGAGATGG + Intergenic
1048255221 8:132900514-132900536 CTCCCAAGAAACTGCAGAGATGG - Intronic
1049044280 8:140137076-140137098 CTCAGGAAAAAGCGGGGAGAGGG + Intronic
1049995715 9:1032049-1032071 CTGAGACAGAAGTTCAGAGAAGG - Intergenic
1050084420 9:1949825-1949847 ATGAGAAAAAAGGGCAGAGATGG - Intergenic
1050157975 9:2687681-2687703 AAAAGAAAAAAGTGAAGAGATGG + Intergenic
1050845371 9:10210315-10210337 CTCAGACAAAAGTGAGAAGATGG + Intronic
1052003228 9:23314037-23314059 TTAGGAAAAAAATGCAGAGATGG + Intergenic
1052151604 9:25123828-25123850 CTAAGAAAAAAGAGCAAAGTGGG - Intergenic
1052253871 9:26430666-26430688 CTCAGCAAAATCTGCACAGAAGG + Intergenic
1052875194 9:33554423-33554445 CTCAGTAAAAAGGTCAGAGCTGG + Intronic
1053082526 9:35189325-35189347 CCCAGACAGAAGTGCAGATAAGG + Intronic
1053110800 9:35458074-35458096 CTCATCAAAAAGTGGAAAGAAGG - Intergenic
1053500827 9:38589907-38589929 CTCAGTAAAAAGGTCAGAGCTGG - Intergenic
1056110943 9:83394139-83394161 GTCTGAAAAATGGGCAGAGAAGG - Intronic
1056493485 9:87131975-87131997 CTCAGCAAAAAGAACAAAGATGG + Intergenic
1056663400 9:88561192-88561214 GGCAGAAAAACGTGAAGAGATGG + Intronic
1057041661 9:91852835-91852857 CTCTGAAGAGAGTGAAGAGAAGG + Intronic
1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG + Intergenic
1057349456 9:94283106-94283128 ATCAGAAAAAATTACAGAGTAGG + Intronic
1057680234 9:97174400-97174422 CTCAGTAAAAAGGTCAGAGCTGG - Intergenic
1057748612 9:97772128-97772150 CACAGCCAAAAGTGCAGACAAGG + Intergenic
1058195967 9:101976327-101976349 CTTTGAATAAAGTACAGAGAAGG + Intergenic
1059711918 9:116875882-116875904 CTCAGAAAAATGAGCTGTGATGG + Intronic
1060306679 9:122419950-122419972 ATCAGAGAGAAGTGCAGATAAGG + Intergenic
1060454211 9:123775606-123775628 CACACAAAAATGTGCACAGATGG + Intronic
1060486016 9:124046514-124046536 CTCAGAAAAAAAAAGAGAGAGGG - Intergenic
1061231730 9:129319504-129319526 CTGAGAAAAAAGAGAAGAGCGGG - Intergenic
1061303410 9:129719143-129719165 CTCAGAGCAAACTGCAGAGTTGG + Intronic
1185679156 X:1874070-1874092 ATGAGAGAAAAGTGGAGAGAAGG - Intergenic
1186094100 X:6081285-6081307 CTCAAAAAAAATTGTAGAGACGG + Intronic
1186527888 X:10266356-10266378 CTGAGAACAAATAGCAGAGATGG + Intergenic
1186940441 X:14501139-14501161 CGCAGAAACAAATGCTGAGAGGG - Intergenic
1187539622 X:20179404-20179426 GTCAGGAAAGAGTGCAGAGGGGG + Intronic
1189344991 X:40234016-40234038 CCCAGAAGAAAGGTCAGAGATGG - Intergenic
1189663541 X:43328389-43328411 CTCATAAAAACTTGCAGAGCAGG - Intergenic
1190447232 X:50538406-50538428 ATCAGAAAAAAATCCTGAGAGGG + Intergenic
1191005729 X:55709749-55709771 CTCAGATAGAAGTGCAGATAAGG + Intergenic
1191111017 X:56803226-56803248 CTCCGAAAAAAGGGCAGGAAGGG + Intergenic
1191120864 X:56903037-56903059 CACAGAAAGTAGTGCAGATAAGG - Intergenic
1191613190 X:63138528-63138550 CACAGAAAGAAGTGCAGATAAGG - Intergenic
1191623107 X:63240398-63240420 CACAGAAAGAAGTGCAGATAAGG + Intergenic
1192510310 X:71717285-71717307 CCCAGAAGAAAATGCAGAGCAGG - Exonic
1192516387 X:71764268-71764290 CCCAGAAGAAAATGCAGAGCAGG + Exonic
1192741772 X:73900297-73900319 CTCAAAAAAAAGGGGAGAGTGGG + Intergenic
1193363884 X:80607881-80607903 CCCAGACAAAAGTGCAGATATGG - Intergenic
1193705469 X:84815934-84815956 CTCAGACAGAAGTGCAGATAAGG + Intergenic
1194086051 X:89530392-89530414 ATCAGACAGAAGTGCAGATAAGG + Intergenic
1194091879 X:89587392-89587414 CTCATAAAAACTTGCAGAGCAGG + Intergenic
1194104862 X:89756566-89756588 CTCATAAAAACTTGCAGAGCAGG - Intergenic
1195084481 X:101401255-101401277 CTGAGGAAGTAGTGCAGAGATGG + Intronic
1195245095 X:102988103-102988125 CCTAGAAAAACATGCAGAGAAGG - Intergenic
1196374122 X:115012964-115012986 GTGAGAAAAAAATGTAGAGATGG + Intronic
1197481205 X:126988746-126988768 CCCAGACAGAAGTGCAGATAAGG - Intergenic
1197591335 X:128414561-128414583 CTCAGCAAAATGGGCATAGAAGG - Intergenic
1197611809 X:128647778-128647800 CTCAGCAAAATCTGCATAGAAGG + Intergenic
1198029405 X:132740576-132740598 CTAAGAAAAAAGAGAAGAAAGGG + Intronic
1198252074 X:134889690-134889712 ATAAAAAAAAAGTACAGAGAAGG + Intronic
1199121914 X:144064741-144064763 CTCAGCAAAAACAGCAGAGAAGG + Intergenic
1199229261 X:145416825-145416847 ATCAGAAAAAAGTGGAAAAATGG - Intergenic
1199633958 X:149797451-149797473 CTCAGAGAAAATAGAAGAGAAGG - Intergenic
1199658963 X:150027850-150027872 CTTATATAAAAGTACAGAGATGG - Intergenic
1200438707 Y:3186264-3186286 ATCAGACAGAAGTGCAGATAAGG + Intergenic
1200444518 Y:3243454-3243476 CTCATAAAAACTTGCAGAGCAGG + Intergenic
1200456826 Y:3404355-3404377 CTCATAAAAACTTGCAGAGCAGG - Intergenic
1200619949 Y:5431142-5431164 TTCAGAAAAAATTGCAGTCAAGG + Intronic
1201383223 Y:13409330-13409352 CTCAGAAAAAAGTGGAGCTGAGG - Intronic