ID: 998421786

View in Genome Browser
Species Human (GRCh38)
Location 5:141994214-141994236
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998421783_998421786 5 Left 998421783 5:141994186-141994208 CCTGTAGACTGTATAGAGCCTTG 0: 1
1: 0
2: 0
3: 2
4: 60
Right 998421786 5:141994214-141994236 ACTTTGGCTGCCACTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr