ID: 998422627

View in Genome Browser
Species Human (GRCh38)
Location 5:142001464-142001486
Sequence CTGTGAAAGTGGAAGAAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 565}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998422613_998422627 23 Left 998422613 5:142001418-142001440 CCACCCACCCAAATCCACCCCCA 0: 1
1: 0
2: 6
3: 133
4: 1012
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422623_998422627 3 Left 998422623 5:142001438-142001460 CCAGGTTCTCCTAGTTCAGAGAA 0: 1
1: 0
2: 0
3: 11
4: 158
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422618_998422627 15 Left 998422618 5:142001426-142001448 CCAAATCCACCCCCAGGTTCTCC 0: 1
1: 1
2: 1
3: 19
4: 234
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422621_998422627 5 Left 998422621 5:142001436-142001458 CCCCAGGTTCTCCTAGTTCAGAG 0: 1
1: 0
2: 2
3: 15
4: 155
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422622_998422627 4 Left 998422622 5:142001437-142001459 CCCAGGTTCTCCTAGTTCAGAGA 0: 1
1: 0
2: 0
3: 18
4: 144
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422616_998422627 19 Left 998422616 5:142001422-142001444 CCACCCAAATCCACCCCCAGGTT 0: 1
1: 0
2: 5
3: 24
4: 267
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422612_998422627 24 Left 998422612 5:142001417-142001439 CCCACCCACCCAAATCCACCCCC 0: 1
1: 0
2: 6
3: 75
4: 726
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422615_998422627 20 Left 998422615 5:142001421-142001443 CCCACCCAAATCCACCCCCAGGT 0: 1
1: 0
2: 3
3: 32
4: 272
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422611_998422627 25 Left 998422611 5:142001416-142001438 CCCCACCCACCCAAATCCACCCC 0: 1
1: 0
2: 10
3: 99
4: 904
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422624_998422627 -6 Left 998422624 5:142001447-142001469 CCTAGTTCAGAGAAAAGCTGTGA 0: 1
1: 0
2: 0
3: 32
4: 310
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422619_998422627 9 Left 998422619 5:142001432-142001454 CCACCCCCAGGTTCTCCTAGTTC 0: 1
1: 0
2: 2
3: 15
4: 238
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422617_998422627 16 Left 998422617 5:142001425-142001447 CCCAAATCCACCCCCAGGTTCTC 0: 1
1: 0
2: 2
3: 17
4: 270
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565
998422620_998422627 6 Left 998422620 5:142001435-142001457 CCCCCAGGTTCTCCTAGTTCAGA 0: 1
1: 0
2: 1
3: 17
4: 227
Right 998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG 0: 1
1: 0
2: 7
3: 51
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998422627 Original CRISPR CTGTGAAAGTGGAAGAAGGA AGG Exonic
900747613 1:4371868-4371890 CTGTCAATCTGGAAGGAGGAAGG - Intergenic
901881053 1:12194049-12194071 CTGAACAAGTGGATGAAGGAAGG - Intronic
901975145 1:12938536-12938558 CTCTGAAAGTGGGAAAGGGAAGG - Exonic
902264439 1:15251918-15251940 CTGTTAGAGAGGGAGAAGGAAGG - Intronic
902706193 1:18206674-18206696 CTGAGAAAGTGGTAGAAGTGAGG + Intronic
902872810 1:19324610-19324632 CTGTGGAAGAGGAAGAGGAAGGG - Intronic
903313287 1:22477885-22477907 GTGGGAAAGGGGAAGAAGGAAGG - Intronic
903998475 1:27323045-27323067 CTGTCAAGGTTGAAGCAGGAGGG - Intronic
904357510 1:29950189-29950211 TTGTGAAGGAGAAAGAAGGAAGG - Intergenic
905326757 1:37158465-37158487 CTGGGGAAGTGAGAGAAGGAGGG + Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905874100 1:41421450-41421472 CTGGGAAGGGGGAAGAAAGATGG + Intergenic
906100606 1:43257953-43257975 CTGTGCACCTGGAAGCAGGAGGG + Intronic
906751158 1:48262427-48262449 ATGTGCAAGTGGAAAATGGATGG - Intergenic
907332991 1:53683493-53683515 CTGTGAAATGGGGAGAATGAGGG + Intronic
907907865 1:58800679-58800701 CACTGAAACTGGCAGAAGGAGGG + Intergenic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908065191 1:60395826-60395848 CTGAGAAAGTGGAGGAAGCCAGG + Intergenic
908874088 1:68649717-68649739 CTGTGAAAGGGAAAGAAGGATGG - Intergenic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
913266640 1:117051623-117051645 CTGTGAGAGTGAAAGCAGGAAGG + Intergenic
913653476 1:120940007-120940029 GGGTGAAAGGGAAAGAAGGAAGG + Intergenic
914167621 1:145189021-145189043 GGGTGAAAGGGAAAGAAGGAAGG - Intergenic
914519167 1:148400131-148400153 GGGTGAAAGGGAAAGAAGGAAGG + Intergenic
914643660 1:149634166-149634188 GGGTGAAAGGGAAAGAAGGAAGG + Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915718864 1:157968906-157968928 CTGTGCAAGCTGATGAAGGAGGG - Intergenic
916428987 1:164709670-164709692 TTGGGAAAGTGGAAGAGCGAAGG + Intronic
917270365 1:173266102-173266124 GTGTGCAAGAGTAAGAAGGATGG + Intergenic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
918262142 1:182805979-182806001 AGGTGAAAGTGGAAAAAAGATGG + Intronic
918385714 1:184005398-184005420 CTTTGCTAGTGGCAGAAGGATGG + Intronic
918827655 1:189346454-189346476 CTTTGAAGATGGAAGAAGAAGGG - Intergenic
919020632 1:192100873-192100895 GTGTAAGAGTTGAAGAAGGAAGG + Intergenic
919667607 1:200307086-200307108 CTGTGAAAGTATGAGAAGCATGG - Intergenic
921252441 1:213310485-213310507 CTGTGAAAGAACCAGAAGGAAGG - Intergenic
921726580 1:218531061-218531083 GTGTGGAAGTTGTAGAAGGAAGG - Intergenic
922143237 1:222911457-222911479 CTGTAAAAGAGGAAAAAGAAGGG - Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
923049674 1:230381893-230381915 CTGTGAGAGTGGATGTAGGATGG - Intronic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923284047 1:232474073-232474095 CTGTGAATGGGGAAAAGGGATGG + Intronic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923514189 1:234680855-234680877 CTGAGGAAGTGAAAGATGGAGGG + Intergenic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
924373486 1:243382006-243382028 TTCTGAAAGTGGAAGAAAGTGGG + Intronic
1062839603 10:659858-659880 CTGGGAAAGAGAAAGCAGGAAGG - Intronic
1062905739 10:1178436-1178458 CCGAGAAAGTGAAGGAAGGATGG - Exonic
1063245747 10:4216454-4216476 CTTAGGAAGGGGAAGAAGGATGG + Intergenic
1063490806 10:6462028-6462050 CAGTGAAAATGGGAAAAGGAAGG + Intronic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064813781 10:19232821-19232843 CAGTGAAAGAGCAAGAAGCAGGG - Intronic
1065667164 10:28074810-28074832 CCGTGAAAGTGGAAACATGAAGG - Intronic
1066681100 10:37937572-37937594 CTCTGTCAGTGGGAGAAGGAGGG - Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067084035 10:43228869-43228891 CTGAGTAAGTGAAAGAAGGAAGG + Intronic
1067438370 10:46294411-46294433 CTGGGAAAGTGGAGGGAGGCAGG + Intronic
1067821866 10:49538024-49538046 TTGTGAAAATGCAAGAAGGCTGG + Intronic
1068054333 10:51992403-51992425 TTGTAAAAATGGAAGAGGGAGGG + Intronic
1068110851 10:52679053-52679075 CTGTGAAAGATAATGAAGGAGGG + Intergenic
1068606064 10:59006270-59006292 CTGTGAAGCTGGAGGGAGGAAGG + Intergenic
1068698949 10:59999869-59999891 TTTGCAAAGTGGAAGAAGGAGGG - Intergenic
1070481244 10:76884739-76884761 TTTAGAAAGTGGAAGAAGGAAGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070782344 10:79145014-79145036 CTGGGCAAGAGGAAGAAAGAAGG - Intronic
1071104672 10:82080459-82080481 ATGGGAAGGTGGCAGAAGGAGGG - Intronic
1071551989 10:86573329-86573351 ATGTAAAGGTGGAAAAAGGATGG - Intergenic
1071689811 10:87805188-87805210 GTGTGAATGTGGGAGGAGGAAGG - Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073061649 10:100737086-100737108 ATGGGAAAGGGAAAGAAGGAGGG - Intronic
1073173552 10:101534533-101534555 CTGGGAGAGTGGGAGAAGGAAGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074198803 10:111213205-111213227 TTGTGAATGTGGAAGAATCAGGG - Intergenic
1074307052 10:112288601-112288623 CTCTGAAAGTGGAAGAAGGGAGG - Intronic
1074671479 10:115796936-115796958 TTATGAAAATGGAAGAAAGAAGG - Intronic
1075230018 10:120668230-120668252 CTGTGGAAGTGGACAAAGCAAGG - Intergenic
1075338017 10:121622738-121622760 TAGAGAAAGGGGAAGAAGGAGGG - Intergenic
1075480354 10:122775817-122775839 CTGTAAAAGGGGAAGAACCATGG - Intergenic
1076163764 10:128266073-128266095 GGGTGAAAGAGGTAGAAGGAGGG - Intergenic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1079794284 11:24779949-24779971 ATGAGAAAGTGGAAGAGGCAAGG + Intronic
1079878303 11:25888944-25888966 CTCTGAAAGTGGAAGACGAATGG + Intergenic
1079989733 11:27233943-27233965 CTGTAACAGTGGAAGAGGGGTGG + Intergenic
1080257672 11:30309456-30309478 CTGAGAAAAAGAAAGAAGGAAGG - Intergenic
1080690593 11:34554576-34554598 GTGATAAAGTGGAAGATGGAAGG - Intergenic
1080692070 11:34566572-34566594 ATCTGCAGGTGGAAGAAGGAAGG - Intergenic
1080913588 11:36631018-36631040 CCGTAAAAGTGGAAGAAGTCAGG + Intronic
1081378768 11:42389506-42389528 AGGTGCAAATGGAAGAAGGAGGG + Intergenic
1081797268 11:45829455-45829477 CTGTGGAGGTGGAAAAAGAAGGG - Intergenic
1082806633 11:57455815-57455837 CTGGGAAAGTGGAGGCAGCATGG + Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1085777604 11:79380641-79380663 CTGTGAACCTCCAAGAAGGAGGG + Intronic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1088629878 11:111764760-111764782 CTGCAAAAGTTGTAGAAGGAGGG + Intronic
1088744461 11:112794032-112794054 AGGAGAAAGGGGAAGAAGGAAGG + Intergenic
1089621047 11:119722450-119722472 ATGTGGAAGTGAAAGAAGGCAGG + Intronic
1090591404 11:128274056-128274078 CTGTGAAAGAACAAAAAGGAAGG + Intergenic
1090624470 11:128593890-128593912 CTGTGAAACTGGAACTAGGGTGG - Intergenic
1090698952 11:129278387-129278409 TTGTGAAACTTGAAGATGGAAGG - Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092040178 12:5377262-5377284 CTGTGAGAGTGGGAGAGAGATGG + Intergenic
1092217861 12:6695242-6695264 CTGAGAGACTGGGAGAAGGAAGG + Intronic
1092751456 12:11723402-11723424 AACTGAAAGTGGAAGAAAGAAGG - Intronic
1093662230 12:21770517-21770539 CTGTGAAAGAAGCAGAGGGAAGG + Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094316797 12:29144884-29144906 ATATGAAGATGGAAGAAGGAAGG - Intergenic
1095111778 12:38302817-38302839 CTTAGAAAATGGAGGAAGGAAGG - Intergenic
1095374590 12:41511542-41511564 CTGTGAAATTCAAATAAGGAAGG + Intronic
1096801437 12:54113077-54113099 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1097311685 12:58125925-58125947 CAGTGAAAGTGTTAGAAGCATGG + Intergenic
1097351691 12:58556027-58556049 CTATGAAAGTTAAAGGAGGAAGG + Intronic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1099097547 12:78393844-78393866 ATGTGAAAGTAGAAGAAGTAAGG + Intergenic
1100353346 12:93805828-93805850 CTGTCAGAGGGAAAGAAGGAGGG + Intronic
1103532488 12:121612047-121612069 CTGTGAAAGGGGAATATTGATGG - Intergenic
1103533266 12:121617332-121617354 CTGTGAAAAAAAAAGAAGGAAGG + Intergenic
1103768382 12:123299886-123299908 CTGTGAAAAGAAAAGAAGGAGGG + Intronic
1104154993 12:126122685-126122707 GTGTCAAACTGAAAGAAGGAAGG - Intergenic
1104162664 12:126194745-126194767 ACGTGAAAGGGAAAGAAGGAAGG - Intergenic
1104266991 12:127242942-127242964 CACTGAAACTGGAAGAATGAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105575812 13:21650574-21650596 CAGAGAAAGAGGAAGAAGGAGGG - Intergenic
1106822526 13:33481623-33481645 GTGTGAATGTGAGAGAAGGAGGG + Intergenic
1107328735 13:39273941-39273963 TTCTGAAAGGGGAAGAATGAAGG + Intergenic
1108257078 13:48621268-48621290 GGGTGAAAGAGCAAGAAGGAGGG - Intergenic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108422728 13:50267175-50267197 CTGCAAAAGTGGAAGAAGCTGGG - Intronic
1110550346 13:76805030-76805052 TTGTGACAGTGCTAGAAGGATGG - Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112379508 13:98875384-98875406 TTTTGAAAGTGAAAGAAGGAGGG - Intronic
1112542315 13:100327221-100327243 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1113166825 13:107452104-107452126 CCATAAAAGTGGAAGGAGGAGGG - Intronic
1113172566 13:107521908-107521930 GTGTGTAAGTTGAAGAAGAAAGG - Intronic
1113607160 13:111617402-111617424 TTGTGAAGCTGGAAGAAAGAAGG - Intronic
1113610681 13:111642777-111642799 CTGTAAAAGTGGAGGCAGAAAGG - Intronic
1114619580 14:24087260-24087282 CAGTAAGAGTGGTAGAAGGAAGG + Intronic
1115091159 14:29577548-29577570 CTGTTAGAGTGGAAGGAGAAGGG - Intronic
1115151566 14:30292331-30292353 CTGGGAAAGAGGAAGAGAGAAGG + Intergenic
1115770219 14:36659309-36659331 CAGAGAAAGAGGATGAAGGAAGG - Intronic
1116370531 14:44125067-44125089 CTTTGAAAATGGAGGAAGGAGGG - Intergenic
1116868837 14:50052826-50052848 CACTGAAAATGGAAGAAAGATGG - Intergenic
1117017530 14:51533784-51533806 CTCTGAAAGTGGAACAGGGGTGG - Intronic
1117803515 14:59467485-59467507 CTGAGAAAGATGAGGAAGGAAGG - Intronic
1118266681 14:64301458-64301480 GTGCTAAAGTGGAAGAACGAGGG - Intronic
1118382665 14:65230048-65230070 CCCTGAAAGTGAAAGAAGAAAGG + Intergenic
1118820524 14:69342451-69342473 GAGGGAAGGTGGAAGAAGGAAGG + Intronic
1118915341 14:70098240-70098262 TTATGGAATTGGAAGAAGGATGG - Intronic
1119049806 14:71356106-71356128 TAGGGAAAGTGGAAGAAGGGGGG - Intronic
1121039033 14:90729856-90729878 ATGTGAAGGTGGGAGAAGGGAGG - Intronic
1121280209 14:92692438-92692460 CTCTAAAAGTGCAGGAAGGAGGG - Intergenic
1121298197 14:92847326-92847348 CTTTGAAGGTGGAGGAAGGAAGG + Intergenic
1121971500 14:98361039-98361061 ATGTAATAGGGGAAGAAGGACGG + Intergenic
1122055868 14:99097979-99098001 CAGTGAATGGGGAAGAAGGCTGG - Intergenic
1123435578 15:20251677-20251699 CTGTGACAGTGACAGAATGAGGG - Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1124012285 15:25848659-25848681 CTGTAAAAGTGGAAGAAAAGCGG - Intronic
1124250631 15:28104606-28104628 CTGAAAAATTGGAACAAGGAAGG - Intergenic
1124411900 15:29443704-29443726 CTGAGAAAGAGCAAGCAGGAGGG + Intronic
1124939296 15:34203195-34203217 TTGAGAAATTGGAAGGAGGATGG - Intronic
1125482058 15:40088025-40088047 CTGGGAGAGAGGAAGAAGAAAGG - Exonic
1125824699 15:42666454-42666476 CCTTGAAACTGGGAGAAGGAAGG + Intronic
1127370197 15:58332004-58332026 TTTTGAAAGTGGAAGAGGGCAGG + Intronic
1127617571 15:60702171-60702193 CTGTGAAACTGAAATAATGATGG + Intronic
1127747303 15:61992232-61992254 CTAGGACAGTGGCAGAAGGAGGG + Intronic
1130396911 15:83510780-83510802 CAGCCAAAGTGGAAAAAGGAAGG + Intronic
1130528263 15:84725402-84725424 TTGTGATAGGGGAAGAATGAAGG - Intergenic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1132811746 16:1802765-1802787 GTGTGACAGTGGTACAAGGAAGG - Intronic
1133244904 16:4441923-4441945 CTGTCAGAGTGGAAGAGAGAGGG + Intronic
1133485457 16:6214843-6214865 CAGGGAAAGAGAAAGAAGGAGGG + Intronic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1134912833 16:18043631-18043653 CTGTGAGAGTGAAATAAGAAAGG + Intergenic
1135506169 16:23038367-23038389 TTCTGGAAGAGGAAGAAGGAAGG + Intergenic
1135544352 16:23355728-23355750 CAGGGAAAGTGGGATAAGGAAGG + Intronic
1135795847 16:25441851-25441873 CTGGGAAAGAGAAAAAAGGAAGG + Intergenic
1136144951 16:28311078-28311100 GTGTGGAAGGAGAAGAAGGAGGG + Intronic
1137615130 16:49841843-49841865 ATGTGAAAGGGAAAGAAGGAGGG + Intronic
1137864253 16:51876933-51876955 CTTTAAAACTGGAAGAATGATGG - Intergenic
1137952380 16:52795940-52795962 CCTTAAAAGTGGAAGAAGGAAGG + Intergenic
1137955666 16:52826401-52826423 CTTTGAAAATGGATGTAGGAAGG - Intergenic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1138741032 16:59310396-59310418 CTTTTAAAGTGGAAAATGGAGGG + Intergenic
1138801177 16:60031850-60031872 CTCTGAAAGAGAAAGCAGGAAGG + Intergenic
1138872411 16:60907150-60907172 ATGTTAAATTGGAAGAAGGAGGG - Intergenic
1139208972 16:65057645-65057667 GAGGGAAAGTGGAAAAAGGAAGG - Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140647589 16:77049958-77049980 CTATGAAAGTGAAATAAGGCAGG - Intergenic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1142358081 16:89613535-89613557 CTCTGAAAGTAGAAAGAGGAGGG - Intronic
1143725628 17:8843318-8843340 ATAAGAAAGAGGAAGAAGGAAGG - Intronic
1143747797 17:9006125-9006147 CTGGAAAAGTGGAAGAAAGTGGG + Intergenic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144442164 17:15293275-15293297 CTGAGAAGATGGAAGAAGGAAGG - Intergenic
1144628994 17:16860712-16860734 CTGTGAAACGGGAAGAACCACGG - Intergenic
1144652419 17:17015402-17015424 CTGTGAAACGGGAAGAACCACGG + Intergenic
1145160566 17:20571278-20571300 CTGTGAAACGGGAAGAACCATGG - Intergenic
1145356901 17:22167298-22167320 GTATGAAAATGGAATAAGGAGGG - Intergenic
1145738940 17:27255892-27255914 CTGTGAAAGAGACAGAAAGAGGG + Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147214368 17:38890789-38890811 GTGTGAATGGGGAAGAGGGAGGG - Intronic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1148171074 17:45520338-45520360 GTGAGAAAGTGGAAGAAGCATGG + Intergenic
1148364948 17:47048214-47048236 GTGAGAAAGTGGAAGAAGCATGG - Intergenic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1149623969 17:58066689-58066711 CTGTGAAAGGAAAAGAAAGAAGG + Intergenic
1150443716 17:65212286-65212308 CAGGGAAAGTTGAAGAATGAGGG + Intronic
1151279881 17:73065502-73065524 CTGTGGAATTGGAAGAGGCAGGG - Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1153060658 18:991569-991591 CAGGGAAGGAGGAAGAAGGAAGG - Intergenic
1153302010 18:3599473-3599495 CTCTGAAGGTGGGAGTAGGATGG - Intronic
1153580829 18:6571664-6571686 CAGAGAGAGTGGAAGAAGAAAGG - Intronic
1153663826 18:7350527-7350549 CTTTTGAAGTGGAAGAAGAAAGG - Intergenic
1154304021 18:13217882-13217904 CTGGGAAAGTGGAAGCAGGGCGG + Intronic
1155306741 18:24485940-24485962 CTGTGAGAATGGAAGAGGAAGGG + Intergenic
1155385819 18:25276046-25276068 CAGTGATAGTGGAAAAAGCAGGG + Intronic
1155724461 18:29062315-29062337 TAGTGAAAGAGGAAAAAGGAAGG - Intergenic
1156194365 18:34757137-34757159 CTCTAAAAGTGGAAAAAGCAAGG - Intronic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158760341 18:60378027-60378049 AAATAAAAGTGGAAGAAGGAGGG - Intergenic
1158992673 18:62886008-62886030 CTGTGAAGCTGGAGAAAGGAAGG + Intronic
1159594944 18:70373913-70373935 CAGTGAATCAGGAAGAAGGAAGG - Intergenic
1160005638 18:75067249-75067271 CAGTGGATGTGGAAGAAGCAGGG + Intergenic
1161351773 19:3797006-3797028 CTGTGAAAGTGCAGGATGTAGGG - Intronic
1161484848 19:4529924-4529946 CAGTGAGAGTTGTAGAAGGAGGG + Intronic
1161829061 19:6589788-6589810 CAGGGAGAGTGGAAGAGGGAGGG - Intronic
1161845917 19:6711916-6711938 CCGTGTAAGTGGAAGGAGCAGGG + Intronic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1162883413 19:13677727-13677749 CAGTAATAGTGGAAGACGGAAGG + Intergenic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164511862 19:28904109-28904131 ATGGGGAAGTGGAAGAAGAAAGG - Intergenic
1164714837 19:30383964-30383986 CTGGCAGAGTGGAAGAAGGAAGG - Intronic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1168176440 19:54631106-54631128 CGGTGAGATTTGAAGAAGGAGGG + Exonic
926606597 2:14904490-14904512 CTGTCATACTGGAAGAAGGTGGG - Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927739192 2:25552279-25552301 CAGTGAGAGTGAAAGAGGGATGG + Intronic
927768281 2:25833927-25833949 CTCTGAAATTAGGAGAAGGAAGG - Intronic
928465927 2:31522318-31522340 CAGAGAAAGTGGAGGAAGGAGGG - Intergenic
929227317 2:39524205-39524227 CTATGAAGATGGAAGAGGGAAGG + Intergenic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
929486301 2:42357948-42357970 CTGTGAGAGTGAAGGAAGGGAGG - Intronic
929566201 2:42986934-42986956 ATGGGAAAGAGGTAGAAGGAAGG - Intergenic
930684086 2:54289215-54289237 GTGACAAAGTAGAAGAAGGAAGG - Intronic
930691641 2:54371386-54371408 GGGTGAATGTGGAATAAGGATGG - Intronic
931767504 2:65469917-65469939 TTGAGAAAGGGGAGGAAGGAAGG - Intergenic
931769261 2:65483739-65483761 TTGGGAAAGTGGGAGAAAGATGG - Intergenic
933449194 2:82424747-82424769 CTTTGAAGTTGGAGGAAGGAGGG + Intergenic
933572009 2:84025093-84025115 CTCTGAAGATGGAGGAAGGAGGG + Intergenic
934237486 2:90244991-90245013 CTGTGAAAGGGTAAGAACCAAGG - Intergenic
934557846 2:95296875-95296897 CTGTGGAAGTGGAAAAGGAAGGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
936290017 2:111216125-111216147 CTGTAACAGTGCAAGAAGGCAGG - Intergenic
936674438 2:114698765-114698787 CTGTGAAAATGCAAGAAGCCAGG - Intronic
937011468 2:118566554-118566576 ATGTGACAGAGGAAGAAGGAGGG + Intergenic
937151445 2:119689119-119689141 CTGTGAAGGACAAAGAAGGAGGG - Intergenic
937305407 2:120867595-120867617 CTGGGTAAGTTGAAGGAGGACGG + Intronic
937318394 2:120946598-120946620 GTGTGGAAATGGAAGAAGAAAGG + Intronic
937415791 2:121713510-121713532 CTGAGCAACTGGAAGAAGGGAGG - Intergenic
937629447 2:124083669-124083691 CTGTGAACGTGGTAGAAAGAGGG - Intronic
937639658 2:124197221-124197243 CTGCAAAGGTGGAGGAAGGAGGG - Intronic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939222661 2:139322518-139322540 CTGTGAAAATGGAAGCCAGATGG - Intergenic
940071611 2:149694644-149694666 CTGTGAAAGTGAAATGAGGCTGG + Intergenic
941416609 2:165229199-165229221 AAATGACAGTGGAAGAAGGAAGG + Intergenic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
942647879 2:178134220-178134242 CTGCAGAAGTGGCAGAAGGAAGG + Intronic
942662198 2:178277775-178277797 CTGGGAGAGTGGAAACAGGAGGG - Intronic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
943169820 2:184384592-184384614 CTTTAAAAGTGGAGGAAGGAGGG - Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
943436572 2:187871072-187871094 CTGAGAAAATGGCAGAAGTAGGG - Intergenic
943865706 2:192922723-192922745 CTGTGTAGGTGCTAGAAGGAAGG - Intergenic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
944636090 2:201677452-201677474 CTGTGAAAGAGTGAGGAGGAAGG - Intronic
944838191 2:203600409-203600431 GTGTGAAAGTGGAGGAACCAGGG + Intergenic
945184392 2:207124403-207124425 GTCTGCAAGAGGAAGAAGGAGGG + Exonic
945230037 2:207578447-207578469 CTGATAAAGTGAAAGAAGCAGGG + Intronic
945983358 2:216334166-216334188 CCTTAAAAGTGGAAGAAGGCAGG + Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946463582 2:219891513-219891535 CTTTGAGACTGGAAGCAGGAAGG - Intergenic
947077677 2:226363816-226363838 CTGTCAAAAGGAAAGAAGGAAGG + Intergenic
947129167 2:226903988-226904010 ATGGGGAGGTGGAAGAAGGATGG - Intronic
947511014 2:230754403-230754425 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947511027 2:230754439-230754461 GAGGGAAAGGGGAAGAAGGAGGG - Intronic
947935431 2:233999645-233999667 CTGTGAATTTGGGAGTAGGACGG - Intronic
948040129 2:234894653-234894675 CTGTAAAATTGGAACAAGAAAGG + Intergenic
948061884 2:235048170-235048192 CTGTTAATGTGGGAGAGGGAAGG + Intronic
948148135 2:235723927-235723949 GTGTGAAAGTGGCAAAAGGAGGG + Intronic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169213197 20:3778863-3778885 TTGTGAGAGTGGAAGTAGGGAGG - Intronic
1169389302 20:5176495-5176517 GTATGAGAGAGGAAGAAGGAGGG + Intronic
1169668924 20:8072711-8072733 TTTTAAAAGTAGAAGAAGGAGGG + Intergenic
1169945883 20:10987479-10987501 CTATAAAAGTGGAAGAATAATGG + Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170210055 20:13839148-13839170 ATTTGAAGGTGGAAGTAGGAGGG + Intergenic
1170282332 20:14664253-14664275 CTGTAACAGTGGAACTAGGAAGG - Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170756672 20:19212063-19212085 CTGTGCCAGGGGAAGAGGGACGG - Intergenic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171795256 20:29561389-29561411 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1171853200 20:30322876-30322898 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1172156643 20:32830477-32830499 CTGGGACACTGGAAGAAAGATGG - Intronic
1172190054 20:33056516-33056538 CAGAGAGAGTGGAAGTAGGAAGG - Intronic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1173096283 20:40031751-40031773 ATTTGAAAGTGGAAGTAGTAAGG - Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174184065 20:48693218-48693240 CTGGGAAGGTGGATGATGGATGG - Intronic
1174197412 20:48783336-48783358 CTGAGCAAGTGGAAGAATGGAGG + Intronic
1174869786 20:54172412-54172434 TTGTAAAGGTGGAATAAGGAGGG - Intronic
1175189499 20:57201821-57201843 CTTTGAGAAGGGAAGAAGGAAGG - Intronic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175967590 20:62667220-62667242 CTGTGAAGTGGGAAAAAGGAAGG + Intronic
1177260972 21:18729368-18729390 GTGGGGAAGTGGAAGAAGCAAGG + Intergenic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1177300522 21:19238856-19238878 TTTTTAAAGTGAAAGAAGGATGG - Intergenic
1177585132 21:23082633-23082655 CTGTTAAAGTGAACGAAGTATGG - Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178521387 21:33290727-33290749 CTGCCAGACTGGAAGAAGGACGG - Intronic
1178667835 21:34564411-34564433 CTGTGAGACTGCCAGAAGGAAGG + Intronic
1178716911 21:34973327-34973349 CTGTGAATGGAGAAGAACGAGGG + Intronic
1178826046 21:36017810-36017832 CTCTGAAAGGGGAAGAAGAGAGG - Intergenic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179164853 21:38927358-38927380 CTTTGAAGATGGAGGAAGGAAGG - Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181829487 22:25548350-25548372 CTCTAAAAGAGGGAGAAGGAGGG + Intergenic
1181959200 22:26610785-26610807 CTTTGAAATGGGGAGAAGGATGG - Intronic
1181976412 22:26733848-26733870 CTTTGATAATGGAGGAAGGAAGG - Intergenic
1182532780 22:30973754-30973776 CTGTGAAAGTGGTAGAGGCCAGG + Intergenic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1183675191 22:39295164-39295186 ATGGGAAAGTGGAAGAAGGCAGG + Intergenic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
949905490 3:8855144-8855166 ATGTGTGAGTGGAAGAAGGGAGG - Intronic
950001919 3:9663315-9663337 TTGGGAAAGAGGAGGAAGGAAGG + Intronic
950199547 3:11033616-11033638 CTGTGACATTGGGAGCAGGAGGG - Intronic
950399219 3:12758122-12758144 TTGTGAAAGTGAAATAAGGCAGG + Intronic
950941093 3:16892382-16892404 CTGTCAAAGTTTAAAAAGGATGG + Intronic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
952569211 3:34694402-34694424 AAGGGAAAGGGGAAGAAGGAAGG - Intergenic
953491052 3:43351440-43351462 ATGTGAATGTGTATGAAGGAAGG - Intronic
954093897 3:48307429-48307451 AAGAGGAAGTGGAAGAAGGAAGG - Intronic
954352546 3:50056968-50056990 CTGTAACACTGGAAGAAGCAAGG + Intronic
954894884 3:53966703-53966725 CTGTGAAGCTAGAAGCAGGATGG - Intergenic
954928292 3:54256968-54256990 CAGTCCAAGTGGATGAAGGAAGG - Intronic
955216978 3:56992284-56992306 CTGTGAAATCTGAAGAATGAAGG + Intronic
955466021 3:59238197-59238219 CGGTGAAAATGGCAGAAGGGTGG + Intergenic
955474561 3:59322600-59322622 CTGTGAAAGTGATGGATGGAGGG + Intergenic
955974763 3:64469242-64469264 CTGGGAAAGAGGAAGATGGCAGG + Intergenic
956703466 3:71979496-71979518 CTCTGAAAATGCAACAAGGAAGG + Intergenic
958908017 3:99963068-99963090 CTTTGACAGTGGCAGAAGGCAGG - Intronic
959802622 3:110512966-110512988 CTGTGAAAGTGGGAAAAGGAGGG - Intergenic
959936328 3:112033136-112033158 GTGTGAAAGGGAAAAAAGGATGG + Intergenic
960195047 3:114755408-114755430 AAGTAAAAGTGGAAGAAGAATGG + Intronic
960363542 3:116743541-116743563 CTCTAAAAGTTGAAGAAGAATGG + Intronic
960386453 3:117026855-117026877 ATGAAAAAGTGGAAGAAGGTGGG + Intronic
961406886 3:126685926-126685948 CTTTAAAAGTGGAAGCAGGCTGG + Intergenic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
962011980 3:131400705-131400727 CTGTGAAAGGGAGAGAAGCAGGG - Intergenic
962345937 3:134619088-134619110 CTGTGGAAGAGGGAGAGGGATGG + Intronic
962404014 3:135084938-135084960 CTGTGAAATGGGGATAAGGAGGG - Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963404691 3:144847486-144847508 CAGAGACAATGGAAGAAGGAAGG + Intergenic
964592855 3:158384998-158385020 TAGTGATTGTGGAAGAAGGAAGG + Intronic
964629735 3:158797568-158797590 CTGTGAAACTGGGAGAAAAAGGG + Intronic
964879747 3:161410236-161410258 CAGTGAAAGTGGATGTAGGGAGG + Intergenic
966475382 3:180338909-180338931 CTGAGAAGGTAGTAGAAGGATGG - Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967290945 3:187919706-187919728 CAGTGAAAGTGGTTGAAAGATGG + Intergenic
967765461 3:193274473-193274495 GTGTGGAAGTGGTAGAATGAAGG - Intronic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969899521 4:10336150-10336172 GTGTGAAAGTGGGAGAGGCAGGG - Intergenic
970167011 4:13249373-13249395 CAGTGAAAGTGGTAGAATAAAGG - Intergenic
970550066 4:17171450-17171472 CTGTGAGAGGGGTAGAAGGTGGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972233279 4:37099853-37099875 CTATGAAGGTGGAGGAAGGGGGG + Intergenic
973039534 4:45453225-45453247 CTGGGATAGTGGAAGAAGGAGGG - Intergenic
973570241 4:52231405-52231427 CAGTGAAGGTGGAGGATGGATGG + Intergenic
973715473 4:53671352-53671374 CTGTGAAAGATAAAGGAGGAAGG - Intronic
973959683 4:56097282-56097304 CTGGGAGAGTGGAAGATGAATGG + Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
974661238 4:64892284-64892306 CAGTGAAAGTCAAAGAAAGAAGG + Intergenic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977441978 4:97079413-97079435 CTTTGAAAATGGAAGAAGGAGGG - Intergenic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
977809244 4:101340061-101340083 CTGTGAAACCGGAAGAATGATGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
979366948 4:119836859-119836881 TTGTGAAATTGGTAGAATGATGG + Intergenic
979808368 4:125003450-125003472 TTGTGAAAGAGAAAGAATGAAGG - Intergenic
979834951 4:125354681-125354703 GTGTGGAAATGGAAGAATGAAGG + Intronic
980088333 4:128415813-128415835 CTGTGACAGTGCAATGAGGAAGG + Intergenic
980164893 4:129213865-129213887 CTGTGAAATTGGCAGCATGATGG + Intergenic
980850116 4:138371114-138371136 ATTTGGAAGTGGAATAAGGAAGG + Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981786876 4:148489440-148489462 CTGAGGAACTGGAAGAATGAAGG - Intergenic
981787093 4:148491767-148491789 CTGAGGAATTGGAAGAATGAAGG - Intergenic
981972300 4:150678635-150678657 TTATGAAAGGGGAACAAGGAGGG + Intronic
982134712 4:152263767-152263789 CTGTGTAATTGGAAAAATGAAGG - Intergenic
982519001 4:156389511-156389533 CTTTAGAATTGGAAGAAGGATGG - Intergenic
984694673 4:182767668-182767690 TAGTGAAAGTGGGAGAAAGATGG + Intronic
984862352 4:184252279-184252301 CCCTGAATGTGGAAGAGGGAAGG + Intergenic
984901218 4:184588136-184588158 CTCTGAAAGTGGATGCAGCAAGG - Intergenic
985295200 4:188430488-188430510 CTCTGAGAGGGAAAGAAGGACGG - Intergenic
986060865 5:4188800-4188822 ATGAGAAAGTGGAAGTAGCAAGG + Intergenic
986177874 5:5367109-5367131 GAGAGAGAGTGGAAGAAGGAGGG - Intergenic
986339433 5:6776557-6776579 CTGGGACAGAGGGAGAAGGATGG - Intergenic
986763499 5:10901538-10901560 AGGGGAAAGTGCAAGAAGGAGGG - Intergenic
987237339 5:15956177-15956199 CTGTGAAAGTGTAAGGACTAAGG + Intergenic
989115707 5:37950489-37950511 ATGGGAAGGTGGAAGAAGGGTGG + Intergenic
989662907 5:43818590-43818612 CCATGAAAGAGAAAGAAGGAAGG - Intergenic
990010743 5:50994646-50994668 TGGTGAAAGTGGAAGGAGAAGGG - Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
991577431 5:68119786-68119808 CTATGAAAATGGTAGTAGGAAGG + Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
992442392 5:76808368-76808390 GTGGGAATGTGGAAGAAGGAGGG - Intergenic
992816264 5:80442653-80442675 CTGGGAAAGTGGAGGAGGTAAGG + Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993340547 5:86719968-86719990 CTGAGAAAATGTAGGAAGGAGGG + Intergenic
993382599 5:87224841-87224863 CTTTGAAAATGGAAGAATGGAGG + Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994811764 5:104528338-104528360 CTGTGAAAGTGGACTACAGAAGG + Intergenic
994894376 5:105683633-105683655 CAGTTAAAGTGGATGAAAGAAGG - Intergenic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995222851 5:109670558-109670580 CTGCCAAAGTCAAAGAAGGAGGG + Intergenic
995310663 5:110707071-110707093 TTGTAAAAGTGGAAGCAAGATGG + Intronic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
995708244 5:115007692-115007714 CTTTGGAAGAGGAAGAAGGCAGG + Intergenic
997424195 5:133792091-133792113 CTGTGAACCTGGCAGGAGGAAGG - Intergenic
997783281 5:136681766-136681788 GTGTGAGTGTGGAAGAAGGCGGG + Intergenic
997836227 5:137195537-137195559 CTGGGGCAGTGGATGAAGGATGG + Intronic
998084811 5:139311505-139311527 CTTTCAAAGTGAAAAAAGGAAGG - Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
998529517 5:142871828-142871850 CTGTGAAAGTGACTGAACGAGGG + Intronic
998630962 5:143898095-143898117 CTGAGGAAGTGGGAGAAGCAGGG - Intergenic
998917794 5:147034941-147034963 CAGTGATGGTGGTAGAAGGAGGG + Intronic
999076232 5:148798328-148798350 CTGTGAAATAGGGAAAAGGAGGG + Intergenic
1000380092 5:160621125-160621147 CTGTGAGCGTGGAGAAAGGAAGG + Intronic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001829578 5:174774218-174774240 CAGAGAAGGTGGAAGCAGGAAGG - Intergenic
1002625102 5:180521178-180521200 GTGTGAAAGAGGAGGAAAGAGGG + Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003518902 6:6840974-6840996 CCGTGAATGGGGAAGTAGGAGGG - Intergenic
1004107022 6:12675299-12675321 TTGTGAGAGAGTAAGAAGGATGG + Intergenic
1004184546 6:13410806-13410828 AGGAGAAAGAGGAAGAAGGAGGG + Intronic
1004199979 6:13539060-13539082 ATGTTAAAGTGTAAAAAGGAAGG - Intergenic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1004726067 6:18312351-18312373 GGGTGAAAGTGGCAGGAGGAGGG + Intergenic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006285358 6:33089087-33089109 TGGTGAAAGTGGAAGGAGGTGGG + Intergenic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007111896 6:39317650-39317672 CTGTGAAAGAGGAAGGGTGAAGG - Intronic
1007135408 6:39516570-39516592 CTGGGAAAGTGGGAGAAGCCTGG + Intronic
1007291152 6:40787898-40787920 GTGGGAAAGTGAAACAAGGAAGG + Intergenic
1007292536 6:40798402-40798424 CTGGGAGAGAGGAAGAGGGAGGG + Intergenic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1010732164 6:79402843-79402865 GTGTCTGAGTGGAAGAAGGAAGG - Intergenic
1010987654 6:82443413-82443435 CTGAGAAAGTTCAAGAAGGAGGG + Intergenic
1011486965 6:87852840-87852862 CTATTAAAGGGGAAGAAGGGAGG - Intergenic
1011995214 6:93578124-93578146 CTGTGAAAAGTGAAAAAGGAAGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1015204815 6:130624223-130624245 CTGGGAAAGTCCACGAAGGAAGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017586884 6:155936320-155936342 ATGAGTAAGTGGCAGAAGGAAGG + Intergenic
1017909154 6:158778075-158778097 CTGTGAAAGTGGCACCAGGTAGG + Intronic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018287298 6:162254671-162254693 CTCTGGCAGTGGATGAAGGATGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018992523 6:168684904-168684926 CTGACAAAGTGAAAGCAGGAAGG - Intergenic
1019052620 6:169194788-169194810 CTGTGTTACTGGAAAAAGGATGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019646851 7:2135217-2135239 GTGTGCAGTTGGAAGAAGGAGGG - Intronic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1020837876 7:13177189-13177211 GTGGGAAAGTAGAAGAGGGACGG - Intergenic
1021618269 7:22524651-22524673 CTATGAAAGAGGAAGAAAGCGGG + Intronic
1021622556 7:22563101-22563123 CTGTGATATTGGAATATGGAAGG + Intronic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022052413 7:26690319-26690341 CAGTGAAAGTGGAAGAACAAAGG - Exonic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022694679 7:32692622-32692644 CTATGAAAGAGGAAGAAAGCAGG + Intergenic
1022927862 7:35074122-35074144 CTATGAAAGAGGAAGAAAGCGGG + Intergenic
1024246174 7:47472033-47472055 CTGAGAAGGTGGAAGAGGCAGGG - Intronic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026407545 7:70083020-70083042 TTATGAAATTTGAAGAAGGAAGG - Intronic
1026567533 7:71501791-71501813 GTGAGAAAGAGGGAGAAGGAAGG - Intronic
1026614178 7:71887080-71887102 GTGTGAAGGTGTAAGGAGGATGG + Intronic
1026647916 7:72188820-72188842 CTGAGAAGGTGGGAGAAAGACGG - Intronic
1026814355 7:73498510-73498532 TTGTGAAAGAGGATGAAGGAAGG - Exonic
1026978659 7:74514088-74514110 CTGTGAAAGGGGAGGACGGGTGG + Intronic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1028374413 7:90131469-90131491 CTATGAAAGAGGAAGAAAGCAGG - Intergenic
1028519323 7:91712312-91712334 ATGGGAAGGAGGAAGAAGGAAGG + Intronic
1029365988 7:100116739-100116761 GGATCAAAGTGGAAGAAGGAAGG - Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1030881787 7:114889041-114889063 CTGTCAAAATCTAAGAAGGAAGG - Intergenic
1030881802 7:114889132-114889154 CTGTCAAAATCTAAGAAGGAAGG - Intergenic
1031623664 7:123967671-123967693 CTGCTAAAATGCAAGAAGGAAGG + Intronic
1031884031 7:127227187-127227209 CTCTGAAACTGGGACAAGGATGG + Intronic
1032317972 7:130857799-130857821 CTGTAAATGTGGAGGAAGAAGGG + Intergenic
1032752991 7:134861071-134861093 CTGGGAAGGAGGAAGAAGCATGG + Intronic
1033681423 7:143599859-143599881 ATGTGAAAGTGACAGAGGGAAGG - Intergenic
1033703469 7:143861954-143861976 ATGTGAAAGTGACAGAGGGAAGG + Intronic
1034328542 7:150260841-150260863 CTTTAAAGGTGGAAGAAGAAAGG - Intronic
1034764671 7:153708547-153708569 CTTTAAAGGTGGAAGAAGAAAGG + Intergenic
1034819348 7:154202564-154202586 CTCGGAAAGGGGCAGAAGGATGG - Intronic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035216198 7:157369229-157369251 CTGTGAGGGTTGATGAAGGACGG - Intronic
1035883049 8:3263397-3263419 CTGTAACAGTGGATGAAGCAAGG - Intronic
1036438519 8:8758750-8758772 CTGTGAAAGTGGAAATGAGATGG - Intergenic
1036622534 8:10434252-10434274 CTGTGAAAGAGTAAAAATGAGGG + Intergenic
1037064700 8:14563301-14563323 AAATGGAAGTGGAAGAAGGAGGG + Intronic
1037606250 8:20439861-20439883 CTGTGGAAGAGGAAGAAACATGG - Intergenic
1038271992 8:26082701-26082723 GTGTGAGTGTGGAAGCAGGAGGG - Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038597515 8:28902335-28902357 CTGTGAAAATGAAGGAGGGATGG - Intronic
1039088991 8:33808423-33808445 CTGGGAAAGTACAAGAAGCATGG + Intergenic
1039280238 8:35976693-35976715 CTATGAAGGTAGAAGAAAGAGGG + Intergenic
1039399322 8:37255328-37255350 GTGTGAGAGTGGTAGAATGAAGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041657781 8:60371036-60371058 CTTTATAAGTGGATGAAGGAGGG + Intergenic
1044602979 8:94024369-94024391 CTGGGAAAGTGCAGGATGGAGGG + Intergenic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1045359804 8:101422434-101422456 GAGTGAAAGGGAAAGAAGGATGG + Intergenic
1045379969 8:101613630-101613652 CTATCAAAGTGGAAGAAGAAAGG + Intronic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1046485128 8:114877384-114877406 CTCTGAAAGTGGATGAAGCAAGG + Intergenic
1046705131 8:117441165-117441187 CTTTAAAAGTGGAAGAAGGTGGG - Intergenic
1047154609 8:122302850-122302872 TTGTGAAAGTGGTAGAAATAGGG + Intergenic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048412935 8:134194422-134194444 CTGTGAAAGATGCAAAAGGAGGG - Intergenic
1048478108 8:134761333-134761355 TTATGACAGTGGAAGAATGAGGG + Intergenic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1050057470 9:1671062-1671084 GTGGGATAGTGGAATAAGGAGGG - Intergenic
1050063789 9:1737730-1737752 CTGTGAAAGGGAATGCAGGAAGG + Intergenic
1050596047 9:7205662-7205684 GGAAGAAAGTGGAAGAAGGAAGG - Intergenic
1050698839 9:8313398-8313420 CTGTGAAAGTAGAATCAGGCTGG + Intergenic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051839482 9:21379053-21379075 AATTGAAAGTGGCAGAAGGAAGG + Intergenic
1052104004 9:24488779-24488801 CTGGGAAAGGGGAAAAAAGATGG + Intergenic
1052171096 9:25397485-25397507 ATGTGAAAGTGGAACGAGGTAGG - Intergenic
1052384235 9:27806017-27806039 GTGTGGAAGAGGAAGAAGTAGGG + Intergenic
1053145949 9:35712218-35712240 CTCTGAAAGTGAAAAAAGAAAGG + Intronic
1053260196 9:36656263-36656285 CTGACAAAGTAGAAGATGGAGGG - Intronic
1053790994 9:41686175-41686197 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054154156 9:61628597-61628619 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054179340 9:61897869-61897891 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054473944 9:65559717-65559739 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054658198 9:67682952-67682974 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054881696 9:70151018-70151040 CTATGAATGTGGCAGAATGAAGG - Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055164785 9:73177840-73177862 TTGTGAATGTGGAAGAATGAAGG - Intergenic
1055665600 9:78549797-78549819 CTTAAAAAGTGGAAGCAGGAGGG + Intergenic
1055822925 9:80289500-80289522 GTGTGAATGTTGAAGAAGGAGGG - Intergenic
1056238994 9:84624682-84624704 CTGTGTATTTGGAGGAAGGAGGG - Intergenic
1056469275 9:86889386-86889408 CTGTCAAAGTGAAAAAAGCATGG + Intergenic
1056740223 9:89248083-89248105 CTGTGAGGTTGGAAGAAAGACGG + Intergenic
1056909031 9:90681317-90681339 CTGTTAAAGTGAAACAAGTATGG - Intergenic
1057171689 9:92966669-92966691 CTGTGCATGTGGACCAAGGAAGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057244184 9:93440368-93440390 CAGGCAAATTGGAAGAAGGAGGG + Intergenic
1058877135 9:109254150-109254172 CTCTGGAAGTGTAAGAAGGAAGG - Intronic
1059341438 9:113599727-113599749 TTGGGAAGGTGGAAGAGGGAAGG - Intergenic
1059389875 9:113992392-113992414 TTCTGAAAGTGTATGAAGGAGGG + Intronic
1060078615 9:120619008-120619030 ATGAGAAAGTGAAAGAAGCAAGG - Intronic
1061244773 9:129395854-129395876 ATGAGAAGGTGGAAGGAGGATGG + Intergenic
1062128607 9:134880483-134880505 CTGAGAACGGGGAACAAGGAAGG - Intergenic
1062262988 9:135672091-135672113 CTGGGAAAGGGGAGGAAGCAGGG - Intergenic
1062438661 9:136558844-136558866 CTGAGAATGTGGAAGCAGCATGG + Intergenic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1186428494 X:9484421-9484443 CTGGGAAAGGGGTAGAGGGAGGG - Intronic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186645056 X:11497845-11497867 GTGTTAAAGTGAAAAAAGGAAGG - Intronic
1186799979 X:13083194-13083216 CTGTGAAATGGGAAAGAGGAAGG - Intergenic
1187062259 X:15798261-15798283 CAGTGAAAGTGGAAGAGAAATGG - Intronic
1187479899 X:19645861-19645883 CTGGAAAAATGGAAGTAGGAGGG + Intronic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188301649 X:28511557-28511579 GTTTGGAAGTGGAACAAGGAAGG - Intergenic
1188335321 X:28924848-28924870 CTTTTAAATTGGAAGAAGCAAGG + Intronic
1188762637 X:34051285-34051307 CTATAAAAGTGCAATAAGGATGG + Intergenic
1189762404 X:44335093-44335115 CTGTTAAAATGAAAAAAGGAAGG + Intronic
1192537778 X:71943044-71943066 GTGTGAAAATGGAAGAGGGAGGG - Intergenic
1195418526 X:104647113-104647135 CTGGGATAGGGGCAGAAGGAAGG + Intronic
1195468074 X:105203025-105203047 CTGTGAAACTGGAAGCAAGGGGG - Intronic
1195611500 X:106872314-106872336 CTGTCAAAAAGAAAGAAGGAAGG + Intronic
1196030107 X:111087682-111087704 CTGTGGACGTGGAAGAAAAAGGG + Intronic
1196911167 X:120485907-120485929 CTGAGAAGGTGGCGGAAGGAGGG + Intergenic
1197460845 X:126738689-126738711 TAGTTAAAGTGAAAGAAGGAAGG + Intergenic
1198750553 X:139933006-139933028 CAGAGAAAGTGGAAGTAAGAAGG - Intronic
1199860928 X:151800005-151800027 CAGTGAAGGTGGAAGAGGAAGGG - Intergenic
1199907462 X:152248077-152248099 AAGTGAGAGTGGAAGAAGAAGGG - Intronic
1201540478 Y:15100491-15100513 CTGTGTAAGTGCAGGAAGAAAGG + Intergenic
1201751015 Y:17432189-17432211 CAATGCAAGTGGAAGAAGGTGGG + Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic