ID: 998423243

View in Genome Browser
Species Human (GRCh38)
Location 5:142006311-142006333
Sequence TGGTCTCGAGGAAGGCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998423235_998423243 5 Left 998423235 5:142006283-142006305 CCACATGAAGGAGTGGTAACTCT 0: 1
1: 0
2: 1
3: 9
4: 96
Right 998423243 5:142006311-142006333 TGGTCTCGAGGAAGGCCTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998423243 Original CRISPR TGGTCTCGAGGAAGGCCTGT GGG Exonic