ID: 998429501

View in Genome Browser
Species Human (GRCh38)
Location 5:142058734-142058756
Sequence GGGCCCTGCCCACTTTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998429501_998429511 26 Left 998429501 5:142058734-142058756 CCAAGGGAAAGTGGGCAGGGCCC No data
Right 998429511 5:142058783-142058805 GGAAAATGGGAGTCAGAGTTAGG No data
998429501_998429509 12 Left 998429501 5:142058734-142058756 CCAAGGGAAAGTGGGCAGGGCCC No data
Right 998429509 5:142058769-142058791 AGACTCAGGAAATGGGAAAATGG No data
998429501_998429505 -2 Left 998429501 5:142058734-142058756 CCAAGGGAAAGTGGGCAGGGCCC No data
Right 998429505 5:142058755-142058777 CCAGGAGACTCCTCAGACTCAGG No data
998429501_998429507 5 Left 998429501 5:142058734-142058756 CCAAGGGAAAGTGGGCAGGGCCC No data
Right 998429507 5:142058762-142058784 ACTCCTCAGACTCAGGAAATGGG No data
998429501_998429510 13 Left 998429501 5:142058734-142058756 CCAAGGGAAAGTGGGCAGGGCCC No data
Right 998429510 5:142058770-142058792 GACTCAGGAAATGGGAAAATGGG No data
998429501_998429506 4 Left 998429501 5:142058734-142058756 CCAAGGGAAAGTGGGCAGGGCCC No data
Right 998429506 5:142058761-142058783 GACTCCTCAGACTCAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998429501 Original CRISPR GGGCCCTGCCCACTTTCCCT TGG (reversed) Intergenic
No off target data available for this crispr