ID: 998430807

View in Genome Browser
Species Human (GRCh38)
Location 5:142068281-142068303
Sequence GTGACTGTTCTGAACTATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998430807_998430808 -10 Left 998430807 5:142068281-142068303 CCGTCATAGTTCAGAACAGTCAC No data
Right 998430808 5:142068294-142068316 GAACAGTCACATAGTGAAGCTGG No data
998430807_998430813 29 Left 998430807 5:142068281-142068303 CCGTCATAGTTCAGAACAGTCAC No data
Right 998430813 5:142068333-142068355 TTGACTGAAAAAGCAAGGTGGGG No data
998430807_998430809 -9 Left 998430807 5:142068281-142068303 CCGTCATAGTTCAGAACAGTCAC No data
Right 998430809 5:142068295-142068317 AACAGTCACATAGTGAAGCTGGG No data
998430807_998430811 27 Left 998430807 5:142068281-142068303 CCGTCATAGTTCAGAACAGTCAC No data
Right 998430811 5:142068331-142068353 TGTTGACTGAAAAAGCAAGGTGG No data
998430807_998430810 24 Left 998430807 5:142068281-142068303 CCGTCATAGTTCAGAACAGTCAC No data
Right 998430810 5:142068328-142068350 AACTGTTGACTGAAAAAGCAAGG No data
998430807_998430812 28 Left 998430807 5:142068281-142068303 CCGTCATAGTTCAGAACAGTCAC No data
Right 998430812 5:142068332-142068354 GTTGACTGAAAAAGCAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998430807 Original CRISPR GTGACTGTTCTGAACTATGA CGG (reversed) Intergenic
No off target data available for this crispr