ID: 998435918

View in Genome Browser
Species Human (GRCh38)
Location 5:142108795-142108817
Sequence AAGCACCGCCGCCGCCGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998435918_998435921 5 Left 998435918 5:142108795-142108817 CCTCGGCGGCGGCGGCGGTGCTT 0: 1
1: 0
2: 7
3: 54
4: 315
Right 998435921 5:142108823-142108845 CTGAGAAGAGCGTCTCGCCCGGG 0: 1
1: 0
2: 1
3: 4
4: 81
998435918_998435924 16 Left 998435918 5:142108795-142108817 CCTCGGCGGCGGCGGCGGTGCTT 0: 1
1: 0
2: 7
3: 54
4: 315
Right 998435924 5:142108834-142108856 GTCTCGCCCGGGAGCGGCGGCGG 0: 1
1: 0
2: 2
3: 11
4: 120
998435918_998435920 4 Left 998435918 5:142108795-142108817 CCTCGGCGGCGGCGGCGGTGCTT 0: 1
1: 0
2: 7
3: 54
4: 315
Right 998435920 5:142108822-142108844 CCTGAGAAGAGCGTCTCGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 72
998435918_998435923 13 Left 998435918 5:142108795-142108817 CCTCGGCGGCGGCGGCGGTGCTT 0: 1
1: 0
2: 7
3: 54
4: 315
Right 998435923 5:142108831-142108853 AGCGTCTCGCCCGGGAGCGGCGG 0: 1
1: 0
2: 0
3: 23
4: 311
998435918_998435922 10 Left 998435918 5:142108795-142108817 CCTCGGCGGCGGCGGCGGTGCTT 0: 1
1: 0
2: 7
3: 54
4: 315
Right 998435922 5:142108828-142108850 AAGAGCGTCTCGCCCGGGAGCGG 0: 1
1: 0
2: 0
3: 10
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998435918 Original CRISPR AAGCACCGCCGCCGCCGCCG AGG (reversed) Exonic
900305288 1:2003792-2003814 AAACCACGCCGCCGGCGCCGCGG - Exonic
900409312 1:2505622-2505644 AAGCACCCCCGCCTGTGCCGTGG - Intergenic
900483702 1:2911398-2911420 CAGCAGCGCCGCGGCGGCCGCGG - Intergenic
901086144 1:6613538-6613560 ACACACCGGGGCCGCCGCCGCGG + Intronic
902350109 1:15847963-15847985 AGCCGCCGCCGCCGCCGCCCCGG + Exonic
903205994 1:21782989-21783011 GACCGCCGCAGCCGCCGCCGCGG + Exonic
903514737 1:23902841-23902863 CAGCAACGCCGGCGCCGCCGTGG - Intronic
903883737 1:26529675-26529697 AAGCCCCGCCCCAGCCCCCGCGG - Intergenic
904181398 1:28668988-28669010 GCGTGCCGCCGCCGCCGCCGGGG + Intronic
904620453 1:31772032-31772054 CCGCGCCGCCGCCGCCGCCACGG - Intergenic
904641988 1:31938059-31938081 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
904782932 1:32964389-32964411 AGGCTCCGCCGCCGCCGCCGCGG + Exonic
904814077 1:33182108-33182130 AAGCAACTCCGCCCCCGCAGCGG + Intergenic
905212703 1:36385641-36385663 TTCCACCGCCGCGGCCGCCGGGG + Intronic
905449285 1:38046642-38046664 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
906204395 1:43979335-43979357 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
906411695 1:45584164-45584186 AGCCACTGCCGCCGTCGCCGCGG + Exonic
906960920 1:50419099-50419121 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
908355811 1:63323939-63323961 GAGCGCCGCCGCAGCAGCCGCGG - Exonic
908401130 1:63774053-63774075 AGCCGCCACCGCCGCCGCCGAGG + Exonic
908401229 1:63774418-63774440 ATGCACCGGCCGCGCCGCCGCGG + Exonic
908473809 1:64470103-64470125 AATCACCGCAGCCGCCGCGGCGG + Intergenic
911657612 1:100462894-100462916 AAGCACAGCCACCACCACCGAGG - Intronic
912246276 1:107964919-107964941 GGCCGCCGCCGCCGCCGCCGCGG + Exonic
912411569 1:109483943-109483965 ACGCACCGCCATCACCGCCGCGG - Exonic
912670416 1:111619782-111619804 AGGCGCCGCCGCCGCTCCCGAGG + Exonic
913615720 1:120558171-120558193 AGCCGCCGCCGCCGCCGCCTCGG - Intergenic
914044260 1:144077800-144077822 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
914286155 1:146228794-146228816 CTCCTCCGCCGCCGCCGCCGCGG + Exonic
914574556 1:148952731-148952753 AGCCGCCGCCGCCGCCGCCTCGG + Intronic
914808369 1:151008401-151008423 GAGCCCCGCCTCCGCCGCTGGGG + Intronic
915246348 1:154558628-154558650 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
916065505 1:161132641-161132663 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
919712095 1:200738936-200738958 AGCCGCCGCCGCCGCCGCTGCGG - Intergenic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920385631 1:205568900-205568922 AGGCGCCCCCGCCGCCGCCCGGG + Intronic
922648806 1:227318754-227318776 ATGCTCCGCCACCGCCGCCCGGG - Intergenic
924754786 1:246931492-246931514 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1064443172 10:15371242-15371264 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1064712435 10:18140768-18140790 CGCCACCGCCGCCGCCGCTGTGG - Exonic
1070570643 10:77637740-77637762 TGCCGCCGCCGCCGCCGCCGCGG + Intronic
1070800782 10:79243345-79243367 GGCCGCCGCCGCCGCCGCCGAGG - Intronic
1070800837 10:79243560-79243582 CCGCGCCGCCGCCGCCGCCGGGG + Intronic
1071527469 10:86366664-86366686 AAGCGCCGCTGCCACAGCCGCGG - Intergenic
1071997519 10:91162877-91162899 CAGCGCCGCCGCCGCCGCCGCGG + Intergenic
1071997722 10:91163507-91163529 CAGCAGCGGCGCCTCCGCCGAGG + Intronic
1072719501 10:97771932-97771954 AGCCGCCGCCGCCGCCGCCGCGG + Exonic
1073051654 10:100671116-100671138 GAGACCCGCCGCCTCCGCCGGGG + Intergenic
1073099604 10:100999792-100999814 CAGCCCCGCCTCCGCCTCCGCGG - Exonic
1073123341 10:101134927-101134949 AAACCCCGCCGCAGCCGGCGCGG - Intronic
1076554209 10:131311519-131311541 AGCCGCCGCCGCCGCCGCCCTGG - Exonic
1076614246 10:131745698-131745720 ACGCACTCCCGCCGCTGCCGAGG - Intergenic
1076638912 10:131901018-131901040 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1076881084 10:133239522-133239544 CAGCACCCCCGCCGCCTCCCAGG - Intronic
1077214546 11:1389998-1390020 CGCCGCCGCCGCCGCCGCCGAGG - Intronic
1077674967 11:4187455-4187477 TCGCGCTGCCGCCGCCGCCGCGG - Intergenic
1078659824 11:13277857-13277879 ACTCACCGCCGCCGCCGCCGCGG + Exonic
1079237104 11:18698868-18698890 AGCCGCCGCCGCCGCCGCCATGG + Exonic
1079689405 11:23403534-23403556 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1082986080 11:59172361-59172383 GCGCGCCGCCGCCGCCGCCGGGG - Intronic
1083623650 11:64060936-64060958 CCCCGCCGCCGCCGCCGCCGCGG - Intronic
1083970302 11:66070403-66070425 CGCCCCCGCCGCCGCCGCCGCGG + Intronic
1084128769 11:67118442-67118464 AGGCCCCGGCGCCGCCGCCACGG - Intergenic
1085123604 11:73982850-73982872 AAGCCGCGCCGCCGCCTGCGCGG - Exonic
1086887838 11:92224978-92225000 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1091335338 11:134762206-134762228 CAGCAGCGCAGACGCCGCCGGGG + Intergenic
1091616231 12:2053054-2053076 AAGAGCCGCCGCCGCCGCTCCGG - Intronic
1091823164 12:3491292-3491314 GACCGCCGCCGCCGCCGCCGCGG + Exonic
1091874669 12:3924106-3924128 CAGCACCACGGCCGCCCCCGTGG - Intergenic
1093464976 12:19439851-19439873 CAGCAGCGCCGCCACCGCCTCGG - Exonic
1096983740 12:55743399-55743421 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1097007830 12:55931791-55931813 AAGCAGAGCTGCCGCCGGCGCGG + Intronic
1097232859 12:57522866-57522888 AAGCGCCGCTGCCGCCGCCGCGG - Exonic
1097264420 12:57737514-57737536 CGCCACCGCCGCCGCCGCCGGGG - Exonic
1098255488 12:68611256-68611278 AGGAGCAGCCGCCGCCGCCGCGG + Intronic
1100391734 12:94150076-94150098 GGGAGCCGCCGCCGCCGCCGAGG + Intronic
1101340882 12:103841130-103841152 CACCACCGCCGCCGCTGCCATGG + Exonic
1101592898 12:106139193-106139215 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
1101605885 12:106247623-106247645 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102370948 12:112382090-112382112 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1102853864 12:116277234-116277256 CCGGGCCGCCGCCGCCGCCGGGG + Exonic
1103433026 12:120904104-120904126 CGGAGCCGCCGCCGCCGCCGCGG - Exonic
1103521249 12:121537912-121537934 AGCCGCCGCCGCCGCCGCCGAGG - Intronic
1103563596 12:121804671-121804693 AGCGGCCGCCGCCGCCGCCGCGG + Intronic
1103954250 12:124567588-124567610 CACCGCCGCCGCGGCCGCCGGGG - Intronic
1104049562 12:125186488-125186510 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
1104676510 12:130715294-130715316 CAGCACCCCCGCCTCCCCCGGGG + Intronic
1106208405 13:27620500-27620522 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1106422479 13:29595415-29595437 GAGCCCCGCCGCCGCCGGCTTGG - Exonic
1106512389 13:30422371-30422393 CACCACCGCCGCCGCGGCCAGGG - Intergenic
1106683429 13:32031520-32031542 CAGCGCGGCCGCCGCCTCCGAGG + Exonic
1107276706 13:38687409-38687431 CAGGACCGCCACCGCCGCCCCGG + Exonic
1108227457 13:48303945-48303967 CACCGCCGCCGCTGCCGCCGCGG + Exonic
1110596661 13:77327053-77327075 TACCACCGCCACCACCGCCGGGG + Intergenic
1111951318 13:94711551-94711573 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1112507198 13:99982135-99982157 AGCCGCCGCCGCCGCCGCGGCGG - Exonic
1114612521 14:24052102-24052124 AGGAGCCGCCGCCGCCGCCGGGG - Exonic
1116905093 14:50396643-50396665 AAGCCTCGCCGCCGCCTCCGCGG - Intronic
1117176687 14:53153029-53153051 AGGCGCCGCCGCCGCCGCCTCGG + Exonic
1117803143 14:59465101-59465123 GAGCACGGCCGCCGTGGCCGCGG + Exonic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1118607700 14:67515405-67515427 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
1118849479 14:69573085-69573107 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1118971506 14:70641918-70641940 AGCCGCCGCCGCCGCCGCCTCGG - Exonic
1119484916 14:74980924-74980946 CCGCGCCGCCGCCGCCACCGTGG - Intergenic
1121050438 14:90816329-90816351 AGGCCCCACCGCCGCCGCCGCGG + Exonic
1121767797 14:96502530-96502552 AACCGCCGCCGCTGCCGCCCTGG - Exonic
1122444991 14:101761696-101761718 CGCCGCCGCCGCCGCCGCCGTGG + Intergenic
1122829362 14:104388226-104388248 AAGCACCCCAGCCCCTGCCGGGG - Intergenic
1122878063 14:104677923-104677945 CAGCACCGCAGCTGCCGCCTCGG + Intergenic
1122993283 14:105248924-105248946 CAGCAACGCCGGCGCCGCCGTGG + Exonic
1123024887 14:105419881-105419903 CGCCGCCGCCGCCGCCGCCGAGG - Exonic
1125508788 15:40282031-40282053 CCGCGCCGCCGCCGCCGCTGCGG - Exonic
1125522938 15:40358259-40358281 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1125647378 15:41283949-41283971 AAGCCCCGCCCCCGCCGCTGGGG - Intergenic
1128067853 15:64775591-64775613 TGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1128171514 15:65517589-65517611 TGTCACCGGCGCCGCCGCCGAGG - Intronic
1130076689 15:80695612-80695634 GGCTACCGCCGCCGCCGCCGCGG + Exonic
1132055674 15:98648984-98649006 CCTCAGCGCCGCCGCCGCCGCGG - Exonic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132527627 16:425604-425626 AACTAACGCCGCCGCCGCCCAGG - Exonic
1132641876 16:981780-981802 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1133464737 16:6018967-6018989 CGCCAGCGCCGCCGCCGCCGCGG - Intergenic
1133784410 16:8963566-8963588 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1136459081 16:30398736-30398758 AAGCACCTCCGCACCCACCGTGG + Exonic
1136626353 16:31464550-31464572 CAGCCCCGCCGCCGCCATCGAGG + Exonic
1137531527 16:49281569-49281591 CAGCTCCGCCGCCGCCGCTCTGG + Exonic
1138425961 16:56932226-56932248 CGACACCGCCGCCGCCGCCATGG + Exonic
1138478289 16:57284712-57284734 CGGCTCCGCCCCCGCCGCCGGGG + Intergenic
1139448673 16:67014075-67014097 ACGCAGCGCTGCCTCCGCCGCGG + Intergenic
1139615365 16:68085387-68085409 AGTCGCCGCCACCGCCGCCGCGG - Intronic
1140209183 16:72957815-72957837 CACCGCCGCCGCCGCCGCCCCGG + Exonic
1141054612 16:80804011-80804033 GGCCGCCGCCGCCGCCGCCGCGG + Intronic
1141079201 16:81035951-81035973 AGGAGCCGCCGCCGCCGCCTCGG + Exonic
1142124694 16:88404359-88404381 ACGCACCGCCGGCGCCGCCCAGG - Intergenic
1144816622 17:18039652-18039674 AGGAACCGCCGCCGCCGCGCGGG - Exonic
1146057698 17:29589437-29589459 AGGGGCCGCCGCCGCCGCCCGGG - Exonic
1146332341 17:31937422-31937444 AGCCCCCGCCGCTGCCGCCGCGG - Exonic
1147009887 17:37437165-37437187 AAGCTCCGCCTCCGCCTCCTGGG + Intronic
1148878572 17:50707714-50707736 CAGCGCCGCCGCCGTCGCCGCGG + Exonic
1149430557 17:56593491-56593513 AGCCGCCGCCGCCGCCTCCGCGG + Intergenic
1152049235 17:77959235-77959257 CGGAGCCGCCGCCGCCGCCGGGG + Intergenic
1152704321 17:81834895-81834917 ATCCGCCGCCGCCGCTGCCGTGG + Exonic
1152728741 17:81959955-81959977 GAGGACCGCCGCCCGCGCCGAGG - Intronic
1152729123 17:81961254-81961276 ATGTGCCGCCGCCGCCGCCCGGG + Exonic
1153040816 18:812015-812037 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG + Intergenic
1154268212 18:12897117-12897139 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1157867049 18:51196763-51196785 CACCCCCGCCGCCGCCGCCGCGG + Exonic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160887038 19:1354959-1354981 AAGCCCCGCCCCCGGCCCCGCGG + Intronic
1160921798 19:1524145-1524167 CTGCGCCGCCGCCGCGGCCGGGG - Intronic
1160930702 19:1568310-1568332 CCGCGCCGCCGCCGCCGCCTCGG - Intergenic
1160989476 19:1854586-1854608 AAGCACGCCCGCCGCCACCCCGG - Exonic
1161165591 19:2785550-2785572 AACCGCCGCCACCGCCGCCACGG - Exonic
1161584260 19:5096614-5096636 ACGCACCACCGACACCGCCGGGG - Intronic
1161584315 19:5096812-5096834 ACGCACCACCGACACCGCCGGGG - Intronic
1161703246 19:5805938-5805960 GCTCGCCGCCGCCGCCGCCGGGG + Intergenic
1162033203 19:7926049-7926071 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
1162421672 19:10568984-10569006 CTGCGCCGCCGCCGCCGCTGAGG + Intronic
1162751759 19:12833852-12833874 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1162810740 19:13163181-13163203 AAGCTCCGCCCCCGCCTCCCTGG - Intergenic
1163154474 19:15432492-15432514 CGCCACCGCCACCGCCGCCGCGG - Intronic
1163606979 19:18280983-18281005 CGCCGCCGCCGCCGCCGCCGGGG - Exonic
1163779365 19:19238342-19238364 AAGGACTGCCGCCGCCGCTCCGG + Exonic
1163807252 19:19406450-19406472 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1165509435 19:36257562-36257584 AAGCGCCGCCACCGCCGCCCCGG + Intergenic
1166361253 19:42253868-42253890 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1166802812 19:45468691-45468713 ACCCACCGCCGCCGCCTCCCAGG + Exonic
1167622690 19:50568130-50568152 CAGCCCCACCGCCGCCGCTGCGG - Intergenic
1168073072 19:53963340-53963362 AGGCGCCGCCGCCCCCGCGGTGG - Exonic
1168394547 19:56037280-56037302 AGGCACCGTCGCAGCTGCCGAGG + Intronic
1168549365 19:57280418-57280440 AAGTCCCGCCTCCGCCGCCCTGG - Intronic
1202683781 1_KI270712v1_random:31100-31122 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
926268113 2:11344461-11344483 AAGTGGCGCCGCCACCGCCGCGG + Exonic
927881457 2:26692709-26692731 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
931254111 2:60555286-60555308 AGCCGCCGCCGCCGCCGCCGGGG + Intergenic
933666860 2:84971283-84971305 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
933684769 2:85133940-85133962 AAGCACCGCGGCCACCCCCGGGG + Intronic
934247909 2:90323715-90323737 TTGCATCCCCGCCGCCGCCGTGG - Intergenic
934248016 2:90324088-90324110 CCCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248169 2:90324632-90324654 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248184 2:90324693-90324715 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248358 2:90325306-90325328 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248369 2:90325344-90325366 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248380 2:90325382-90325404 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934248396 2:90325446-90325468 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
934261467 2:91479094-91479116 TTGCATCCCCGCCGCCGCCGTGG + Intergenic
934296814 2:91749016-91749038 CACCCTCGCCGCCGCCGCCGCGG + Intergenic
934304465 2:91809922-91809944 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
934328792 2:92042828-92042850 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935112318 2:100104804-100104826 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
935196646 2:100820245-100820267 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
935592441 2:104855292-104855314 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
935592782 2:104856389-104856411 CGCCGCCGCCGCCGCCGCCGTGG - Exonic
936433184 2:112482010-112482032 CTGCGCCGCCGCCGCCCCCGGGG + Intergenic
939969667 2:148644971-148644993 CCGCCCCGCCGCCGCCGCCCGGG + Exonic
940265134 2:151828359-151828381 AGGCCCCGCCGCTGCCGCCGCGG + Exonic
941119110 2:161507855-161507877 CCCCGCCGCCGCCGCCGCCGCGG + Intronic
942241115 2:173964682-173964704 CGCCGCCGCCGCCGCCGCCGGGG - Intronic
942450899 2:176107580-176107602 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
942890493 2:180981011-180981033 CCCCACCGCCGCCGCCGCCCCGG - Intronic
943571506 2:189580771-189580793 CGCCGCCGCCGCCGCCGCCGTGG + Exonic
943669872 2:190649112-190649134 AGGAGCCGCCGCCGCCGCCGCGG + Intronic
944831219 2:203535342-203535364 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
945466017 2:210171322-210171344 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
945988377 2:216372293-216372315 TATCTCCGCCGCCGGCGCCGCGG + Intergenic
946966440 2:225042281-225042303 CAGCGCCGCGTCCGCCGCCGCGG - Exonic
947506658 2:230713050-230713072 CCGCGCAGCCGCCGCCGCCGCGG + Exonic
947923992 2:233905058-233905080 AAGCTCCGCCTCCGCCTCCCAGG + Intergenic
948216514 2:236237242-236237264 CAGCCCAGCCGCCGGCGCCGGGG - Intronic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948487251 2:238288752-238288774 CAGCGCCGCCGCCTCCGCCGCGG + Intronic
1168965409 20:1895282-1895304 AGCGGCCGCCGCCGCCGCCGCGG - Intronic
1169171830 20:3471355-3471377 CACCGCCGCCGCCGCCGCCGCGG - Exonic
1169214727 20:3786510-3786532 CGGCGCCGCCGCCGCCGCCCCGG + Exonic
1171810657 20:29742810-29742832 CAACACCGCCGCCGCCATCGCGG + Intergenic
1171977590 20:31605405-31605427 CAGCACCGCCACCGCCGCCGCGG + Exonic
1173576561 20:44116007-44116029 AGGCACCGCCTGCGCCGTCGCGG - Exonic
1173672875 20:44810298-44810320 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1174287771 20:49484198-49484220 AGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1176547620 21:8208472-8208494 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1176548596 21:8212230-8212252 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176556490 21:8256438-8256460 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176566571 21:8391519-8391541 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1176567527 21:8395265-8395287 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176574447 21:8435706-8435728 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1176575429 21:8439480-8439502 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1176611059 21:8986998-8987020 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1177011053 21:15730366-15730388 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1178534966 21:33403585-33403607 AGTCTTCGCCGCCGCCGCCGCGG + Exonic
1178992480 21:37367197-37367219 AGGAGCCGCCGCCGCCGCCCGGG + Intronic
1179674987 21:42974965-42974987 AGGCGCCGCCGCCGCCGCGCTGG + Intronic
1179677218 21:42991650-42991672 AAGCTCCGCCTCCGCCTCTGGGG - Intronic
1179951762 21:44712253-44712275 ATGGACGGCCGCTGCCGCCGGGG - Intergenic
1180064420 21:45405389-45405411 AGGCGCCGCCGCCGCGGCCATGG - Intronic
1180650003 22:17369665-17369687 GCGCCCCGCCGCCCCCGCCGAGG + Exonic
1181026853 22:20131825-20131847 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1181087707 22:20449957-20449979 AAGCGTCGCCGCCGCCGCCCCGG - Intronic
1181710697 22:24685945-24685967 AGGCCCCGACGCTGCCGCCGCGG - Intergenic
1181902675 22:26169311-26169333 TGGCACCCCCGGCGCCGCCGCGG + Intergenic
1182308624 22:29388693-29388715 TAGCAGCGCCGCGGCTGCCGAGG - Intronic
1185055240 22:48575801-48575823 CCGCACCATCGCCGCCGCCGGGG - Intronic
1185313824 22:50170433-50170455 GCGCTCCGCCGCCGCCCCCGGGG - Intergenic
1185336175 22:50271779-50271801 AACCGCGGCCGCGGCCGCCGGGG + Intergenic
1185374291 22:50474964-50474986 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1203238467 22_KI270732v1_random:30913-30935 CGCCGCCGCCGCCGCCGCCGGGG + Intergenic
1203252493 22_KI270733v1_random:124757-124779 CACCACCGCCGCCGCGGTCGCGG - Intergenic
1203253480 22_KI270733v1_random:128535-128557 CCGCGCCGCCGCCGACGCCGCGG + Intergenic
1203260550 22_KI270733v1_random:169843-169865 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1203261534 22_KI270733v1_random:173613-173635 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
951217700 3:20040420-20040442 AGGCGCCGCCGCCGCCGCCAGGG - Exonic
951717527 3:25664849-25664871 AGCCGCCGCCGCCGCCGCCACGG + Intronic
951907896 3:27721913-27721935 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
953947773 3:47164011-47164033 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
955368741 3:58332960-58332982 ACGCCCGGCCGCCGCCGCCTAGG - Exonic
955400121 3:58585546-58585568 AGGCACCGCCGCTGCAGACGCGG + Intronic
955911573 3:63863958-63863980 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
956659154 3:71582371-71582393 CGGCGCCGCCGCCACCGCCGTGG + Intronic
956678016 3:71753646-71753668 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
958900140 3:99876283-99876305 CTGCGCCGCCGCCGCGGCCGAGG - Intronic
959530731 3:107431535-107431557 GGTCACCGCCGCCGCCGCCGGGG + Intergenic
961739986 3:129027247-129027269 GAGCACCGCCGCCGCCCGCGGGG - Intronic
963602579 3:147390951-147390973 ACGCGCCGCCACCGCCGCCGAGG + Exonic
963904455 3:150762657-150762679 CGGCCCCGCCGCCGCCGCCGGGG + Exonic
966182200 3:177197562-177197584 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
968565277 4:1309411-1309433 AAGCACCGCCTCCTCTTCCGGGG - Intronic
968701299 4:2059400-2059422 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
968731491 4:2271315-2271337 AAGCACCACTGCCGCAGCTGTGG - Exonic
968965362 4:3766614-3766636 CAGCGCCGCCGCCAGCGCCGGGG - Exonic
970195213 4:13544911-13544933 GGCTACCGCCGCCGCCGCCGGGG - Exonic
972321553 4:37977360-37977382 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
973137316 4:46724426-46724448 GCGCCCTGCCGCCGCCGCCGCGG - Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975985957 4:80202065-80202087 CACCGCCGCCGCCGCCCCCGTGG - Exonic
976146130 4:82044194-82044216 CAGCCCCTCCGCCGCAGCCGCGG - Intronic
978072626 4:104491565-104491587 CAGCAGCGCCGCCGCCGCCGCGG - Exonic
978777204 4:112516020-112516042 GGCCGCCGCCGCCGCCGCCGGGG - Exonic
981782636 4:148444774-148444796 AGGCCCGGCCGCCGCCGCTGGGG - Intergenic
982712205 4:158768942-158768964 CCGCGCCGCCGCCGCCGCCGTGG + Intergenic
984462995 4:180059167-180059189 GAGCGGAGCCGCCGCCGCCGCGG - Intergenic
985312775 4:188619911-188619933 AAGCACGGCCCCCGCAGCCTCGG - Intergenic
985467702 5:12989-13011 AAGCCACCCCGCCCCCGCCGGGG - Intergenic
985749778 5:1667460-1667482 CAGGACCGCGGGCGCCGCCGGGG + Intergenic
985825491 5:2187859-2187881 AAGCACCGGCTCCGCTGCAGTGG + Intergenic
985825615 5:2188780-2188802 AAGCACCGGCTCCGCTGCAGTGG - Intergenic
986330517 5:6713641-6713663 GTGGAACGCCGCCGCCGCCGCGG + Intergenic
986813660 5:11385161-11385183 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
988437531 5:31193807-31193829 CTCCGCCGCCGCCGCCGCCGCGG - Exonic
989229996 5:39074482-39074504 ACCCGCCGCCGTCGCCGCCGAGG - Intergenic
989576457 5:42992663-42992685 CAGCGCCGCCGCCGCCGCCCGGG - Intergenic
990557735 5:56952171-56952193 AGCCGCCGCCGCCACCGCCGCGG + Intronic
990955144 5:61332803-61332825 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
991676558 5:69094291-69094313 CAAGGCCGCCGCCGCCGCCGGGG - Exonic
993900508 5:93581273-93581295 AGCCGCCGCTGCCGCCGCCGGGG - Intergenic
993901219 5:93585113-93585135 CGGCGCCGCCGCCGCCGCCGCGG - Exonic
996055068 5:118973691-118973713 ACGCGCCTCCTCCGCCGCCGCGG + Intronic
996552418 5:124744452-124744474 CAGCACCTCTGCCGCCACCGCGG - Exonic
997698997 5:135883220-135883242 AAGCTCCGCTGCCCCAGCCGGGG - Intronic
997975376 5:138438960-138438982 GCGCGCCGCCGCCGCCGCGGCGG + Intergenic
998118992 5:139561192-139561214 ACGCACCGCCGTCGCCGCCACGG - Exonic
998166675 5:139848292-139848314 GCGCGCCCCCGCCGCCGCCGCGG - Exonic
998435918 5:142108795-142108817 AAGCACCGCCGCCGCCGCCGAGG - Exonic
999326941 5:150649600-150649622 TACCACCTCCTCCGCCGCCGCGG - Exonic
1001065072 5:168529582-168529604 CCGCGCCGCCGCCGCCGCCTCGG - Exonic
1002498510 5:179632364-179632386 TAGCACCCCCTCCCCCGCCGCGG + Intronic
1003139303 6:3457224-3457246 ACGCGCGGCCGCCGCCGCCCGGG + Intergenic
1003206947 6:4021387-4021409 AGCCGCCGCCACCGCCGCCGAGG + Exonic
1003551833 6:7107683-7107705 CGCCGCCGCCGCCGCCGCCGCGG + Intronic
1004864281 6:19837873-19837895 TGCCGCCGCCGCCGCCGCCGCGG - Exonic
1006472662 6:34237336-34237358 CCCCTCCGCCGCCGCCGCCGCGG - Intronic
1006725402 6:36196504-36196526 AGGCGCCGCCGCCGCCGCCACGG - Intergenic
1007666254 6:43515072-43515094 AAGCTCCGCCTCCGCCTCCCAGG + Intronic
1012399998 6:98835071-98835093 CGCCCCCGCCGCCGCCGCCGTGG - Exonic
1013273255 6:108561081-108561103 GGGCGCCGCCGCCGCCGCCTGGG - Exonic
1017672242 6:156778733-156778755 CGCCTCCGCCGCCGCCGCCGGGG + Exonic
1019111974 6:169724109-169724131 CAGCGCCGCCGCCACCGCCATGG + Intronic
1019308227 7:346552-346574 AACCACCACCGCAGCCGCCCGGG + Intergenic
1019308237 7:346586-346608 AACCACCACCGCCGCCGCCCGGG + Intergenic
1019308257 7:346654-346676 AACCACCACCGCCGCCGCCCGGG + Intergenic
1019308276 7:346721-346743 AACCACCACCGCCGCCGCCCGGG + Intergenic
1019308287 7:346755-346777 AACCACCACTGCCGCCGCCCGGG + Intergenic
1019308306 7:346823-346845 AACCACCACCGCCGCCACCCGGG + Intergenic
1019474246 7:1236431-1236453 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1020238524 7:6374696-6374718 GCGCCCTGCCGCCGCCGCCGCGG + Exonic
1022093606 7:27124192-27124214 AATGGCTGCCGCCGCCGCCGTGG + Intronic
1022103806 7:27184599-27184621 AGCCGCCGCCGCCGCCGCGGAGG + Exonic
1023382679 7:39623870-39623892 ACACACCCCCGCCGCCGCCCGGG - Intronic
1023842272 7:44104317-44104339 AAGCCCCGGCGCCCCCGCCCCGG + Intergenic
1025069681 7:55887599-55887621 CGCCGCCGCCGCCGCCGCCGCGG - Intronic
1025615709 7:63114426-63114448 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1028477059 7:91264706-91264728 TACCGCAGCCGCCGCCGCCGCGG - Exonic
1029996754 7:105014154-105014176 CGCCGCCGCCGCCGCCGCCGCGG + Intergenic
1030739064 7:113086568-113086590 CACCGCAGCCGCCGCCGCCGCGG - Intronic
1031051885 7:116953446-116953468 TCGCGCCGCCGCCGCCGCCGCGG - Exonic
1032174359 7:129611698-129611720 TGCCGCCGCCGCCGCCGCCGAGG - Exonic
1034147257 7:148884212-148884234 CGCCGCCGCCGCCGCCGCCGGGG + Exonic
1034469722 7:151248756-151248778 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1034494186 7:151410222-151410244 CACCTCCGCCGCCGCCGCCTGGG + Intronic
1036723729 8:11201069-11201091 CCGCAGCGCCGCCGCCGACGGGG - Exonic
1041059501 8:54022275-54022297 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1041689916 8:60678763-60678785 CGCCGCCGCCGCCGCCGCCGCGG - Exonic
1043464035 8:80487185-80487207 GACCCCCGCCGCCGCCGCCTCGG - Exonic
1045516297 8:102863628-102863650 CGCCGCCGCCGCCGCCGCCGGGG + Intronic
1047203011 8:122782041-122782063 CACCGCCGCCGTCGCCGCCGCGG + Intronic
1049109852 8:140635788-140635810 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1053697501 9:40651086-40651108 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054308790 9:63450486-63450508 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1054440859 9:65258896-65258918 ACCCCCCCCCGCCGCCGCCGCGG - Intergenic
1054798673 9:69325543-69325565 AGTCGCCGCCGCTGCCGCCGCGG + Intronic
1054835655 9:69672554-69672576 CGGTGCCGCCGCCGCCGCCGCGG - Intergenic
1055090996 9:72364835-72364857 AGGTGGCGCCGCCGCCGCCGCGG + Intronic
1055091114 9:72365281-72365303 CGCCGCCGCCGCCGCCGCCGGGG - Intergenic
1057054422 9:91949920-91949942 ATGCACAGCAGCGGCCGCCGCGG + Exonic
1057361146 9:94374747-94374769 GGGCACCGCCGCCGCCTCCGCGG + Exonic
1057489127 9:95508304-95508326 AGCCGCTGCCGCCGCCGCCGCGG + Exonic
1057489144 9:95508367-95508389 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1057489270 9:95508871-95508893 GCGCAGAGCCGCCGCCGCCGCGG + Intronic
1057662215 9:97013417-97013439 GGGCACCGCCGCCGCCTCCGCGG - Exonic
1058467564 9:105244659-105244681 AGCCGCCGTCGCCGCCGCCGGGG + Exonic
1060209083 9:121699426-121699448 GAGCGCCGCCGCCGCCGCCGCGG + Exonic
1060555279 9:124504741-124504763 CCGCGCCGCCGCCGCCGGCGAGG + Intronic
1061196658 9:129110563-129110585 AGTCCGCGCCGCCGCCGCCGCGG + Exonic
1062100356 9:134724808-134724830 AGGCACCACCTCCCCCGCCGAGG - Intronic
1062346302 9:136116905-136116927 ACCTAGCGCCGCCGCCGCCGGGG - Exonic
1062363758 9:136199278-136199300 AGGCGCCGCCCCCGCCCCCGCGG - Intronic
1062452012 9:136619771-136619793 AAGCACCGCAGCCTCCTCTGGGG - Intergenic
1202779846 9_KI270717v1_random:24374-24396 CGCCGCCGCCGCCGCCGCCGCGG - Intergenic
1203468898 Un_GL000220v1:107908-107930 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1203469880 Un_GL000220v1:111682-111704 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1203476719 Un_GL000220v1:151880-151902 CACCACCGCCGCCGCAGTCGCGG - Intergenic
1203477701 Un_GL000220v1:155654-155676 CCGCGCCGCCGCCGCCGCCGCGG + Intergenic
1185457757 X:319237-319259 CGCCGCCGCCGCCGCCGCCGAGG - Intergenic
1187226076 X:17376086-17376108 GGCCGCCGCCGCCGCCGCCGAGG - Exonic
1192925002 X:75747086-75747108 CGCCACCGCCGCCGCCGCCGCGG + Intergenic
1194977593 X:100409720-100409742 CGCCGCCGCCGCCGCCGCCGCGG + Exonic
1201010842 Y:9547359-9547381 AGGCACCGCAGCCGCTGCTGCGG + Intergenic