ID: 998438200

View in Genome Browser
Species Human (GRCh38)
Location 5:142132097-142132119
Sequence TGTTATGTATGTACTCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998438195_998438200 20 Left 998438195 5:142132054-142132076 CCCCAGTCTCTTACATTCATCTA 0: 1
1: 0
2: 1
3: 21
4: 212
Right 998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG 0: 1
1: 0
2: 0
3: 16
4: 166
998438196_998438200 19 Left 998438196 5:142132055-142132077 CCCAGTCTCTTACATTCATCTAA 0: 1
1: 0
2: 1
3: 24
4: 294
Right 998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG 0: 1
1: 0
2: 0
3: 16
4: 166
998438194_998438200 21 Left 998438194 5:142132053-142132075 CCCCCAGTCTCTTACATTCATCT 0: 1
1: 0
2: 2
3: 22
4: 210
Right 998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG 0: 1
1: 0
2: 0
3: 16
4: 166
998438197_998438200 18 Left 998438197 5:142132056-142132078 CCAGTCTCTTACATTCATCTAAG 0: 1
1: 0
2: 2
3: 9
4: 166
Right 998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG 0: 1
1: 0
2: 0
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998438200 Original CRISPR TGTTATGTATGTACTCTTAA GGG Intronic
904276151 1:29385602-29385624 TGTTATGTCTGAACTGTAAAAGG - Intergenic
908146276 1:61247960-61247982 TGTTATTTCTGAACCCTTAAAGG + Intronic
910502394 1:87907922-87907944 TGTAATGTATGATCTCTTTAGGG + Intergenic
911865709 1:103019134-103019156 TGTTTTGTCTGTACTCTTCCTGG - Intronic
912793925 1:112678752-112678774 TGTTTTGTCTTTAATCTTAATGG + Intronic
917150108 1:171933899-171933921 GGTTATGTCTGTACTTTTAGCGG + Intronic
917288830 1:173450491-173450513 TTTTGTGTCTGTGCTCTTAAAGG - Intergenic
919529619 1:198700827-198700849 TGTTATGTAGGTACTCTCAGTGG - Intronic
921730704 1:218575133-218575155 TCATATGTATCTACTTTTAAGGG + Intergenic
922417610 1:225435913-225435935 TGTCATATATGTTCTCCTAAAGG + Intergenic
923495212 1:234518812-234518834 TGATATGTATGTTCTTTTCATGG - Intergenic
1066334415 10:34461777-34461799 TGTGATGTATGTAACTTTAAGGG + Intronic
1068660096 10:59614778-59614800 TGTTATGTAGATAATCTAAATGG - Intergenic
1068722973 10:60267474-60267496 TGTTATTTTTGTAGTTTTAAGGG - Intronic
1068870288 10:61936267-61936289 TGTTTTGTATTTACTATTTATGG - Intronic
1070261938 10:74864854-74864876 TGGTTTGTATGTATTCTTACAGG + Intronic
1072111153 10:92321489-92321511 TTTTGTGTCTGTACTCATAATGG + Intronic
1072819319 10:98540643-98540665 AGTTATTTATGTACTTTTGAAGG - Intronic
1074409868 10:113218764-113218786 TGTTCTTTTTGTACTCTTAAGGG - Intergenic
1076562508 10:131376502-131376524 GCTTATGTATGTTCTCTTCATGG + Intergenic
1077800990 11:5536929-5536951 TGTTTTCTATGTACTCTTTTAGG + Intronic
1079688832 11:23397324-23397346 TGTTATGTTTGTTCTTATAAGGG - Intergenic
1079742550 11:24081131-24081153 TGTTATTTATGCACTACTAAAGG - Intergenic
1080361953 11:31525420-31525442 TGTTATATATGTACTGTTCATGG - Intronic
1086012563 11:82122889-82122911 TGTTATGTCTTTATTCTTATTGG - Intergenic
1086182385 11:83968952-83968974 TGTTATTTCTGTATTATTAAGGG - Intronic
1088237260 11:107738992-107739014 TGTTGGGTATGTACTTTTATTGG + Intergenic
1088936245 11:114403055-114403077 TGTTATGTATCTATTCTAAGGGG + Intronic
1091734590 12:2909444-2909466 TTTTATGTATGTACTCTTTTGGG - Intronic
1092315823 12:7412552-7412574 TGATATGGTTGTAATCTTAAAGG + Intronic
1092606819 12:10129538-10129560 TTTTATGGATATACTTTTAAAGG - Intronic
1097902519 12:64887421-64887443 TGTTATTTTTATACTATTAAAGG - Intergenic
1097957623 12:65502307-65502329 TGTTATATATTTACAATTAAAGG + Intergenic
1098759672 12:74407375-74407397 TATTTTGTTTGTACTTTTAAGGG + Intergenic
1099087261 12:78260964-78260986 TGTAATGAATGTTCTCTTCATGG - Intergenic
1102287767 12:111673186-111673208 TGTTATGAAAGAACTCTTTAAGG + Intronic
1104705556 12:130943575-130943597 TATAAAGTATGTCCTCTTAATGG - Intergenic
1109624650 13:64958859-64958881 TTTTATGTATGTACATGTAATGG + Intergenic
1109876659 13:68414361-68414383 AGTAATGTATGTTGTCTTAAAGG - Intergenic
1110221155 13:73075559-73075581 TGATATGTATTTACTCATAATGG + Intronic
1110583849 13:77164387-77164409 TGTTTTGTATGTATTATAAAAGG - Intronic
1110849534 13:80229479-80229501 TTGTATCTATGAACTCTTAATGG - Intergenic
1115027636 14:28762645-28762667 TGTTATTTAAGTATTCTTTAGGG - Intergenic
1115075995 14:29391022-29391044 TGTTATATATGTTTTCCTAACGG - Intergenic
1115377059 14:32688473-32688495 TGTTATGTATGTCCTCAAGAAGG + Intronic
1115915437 14:38307557-38307579 TGTTAGGTATATACACTTTAAGG - Intergenic
1116332558 14:43614183-43614205 AGTTATGAAGGTTCTCTTAAAGG + Intergenic
1117214929 14:53541093-53541115 CTTAATGTATGTACACTTAAAGG - Intergenic
1117724998 14:58664277-58664299 TGTAAGATATGTACCCTTAATGG - Intergenic
1121704369 14:95980460-95980482 TTTTATGTATGTATTGTGAAAGG + Intergenic
1124706358 15:31969836-31969858 TGTTTTGTATATAATGTTAAGGG - Intergenic
1125143071 15:36432626-36432648 TATTATGTATGTAATCTGCATGG - Intergenic
1126031275 15:44500659-44500681 GGTTGTTTATGTGCTCTTAAAGG + Intronic
1126835106 15:52654601-52654623 CGTTAAGTATGTTCTCTAAATGG + Intronic
1131475761 15:92737593-92737615 TGTTGTGTCTGTGTTCTTAATGG + Intronic
1131956704 15:97743547-97743569 TGTTTTGTGTGTACCCTAAAAGG - Intergenic
1135713653 16:24741535-24741557 TTTTATGTTTGTATTCATAAGGG + Intronic
1135832949 16:25794723-25794745 TGTTTTCTATGTATTCTTATTGG + Intronic
1139810389 16:69610790-69610812 TGTAATGAATGTAGTTTTAAGGG - Intronic
1140015010 16:71174244-71174266 TGTTAAGTATGTACTCCTTGTGG - Intronic
1140998264 16:80282593-80282615 TGTTATGTATGAACCAATAATGG + Intergenic
1141259838 16:82442621-82442643 TGTTTTGCCTGTACTTTTAATGG - Intergenic
1153203735 18:2673576-2673598 TGTTAACAATGTACTGTTAAGGG - Intronic
1154418551 18:14201999-14202021 TGTTTTATATGAACTCTTCATGG - Intergenic
1158983257 18:62786668-62786690 TTTTTTGTATCTACACTTAAAGG + Intronic
1159166211 18:64704069-64704091 TGCTATGTATGAACTTTTATTGG - Intergenic
1162887803 19:13709132-13709154 TTTTATTTATTTACTTTTAAAGG - Intergenic
1168552739 19:57311301-57311323 AGTTATGTGTGTACTCTAAAGGG + Intergenic
925545934 2:5016386-5016408 TTTTAGGTAGGTACTCTAAAGGG + Intergenic
925717367 2:6796714-6796736 TGTTATGTTTATACTTTTATTGG + Intergenic
926960334 2:18351203-18351225 TGTGATGTAAGTACTTTTACAGG - Intronic
927833977 2:26376472-26376494 TGTTAAGTGTGTACTCTAATAGG + Intronic
931729650 2:65141636-65141658 TGTTATATTTGTACCCTTGAGGG + Intergenic
933056568 2:77677320-77677342 AGTTTTGTATGTACTTTTAAAGG - Intergenic
933882629 2:86685706-86685728 TGTTAGGTATGTACACATTAAGG + Intronic
933926644 2:87098086-87098108 AGTTTTGTATGTACTTTTAAAGG - Intergenic
938751394 2:134334044-134334066 TGTTATACATGCACTCGTAATGG - Intronic
939313584 2:140517671-140517693 TATTCTATATGTACTCTTGAAGG - Intronic
939431801 2:142119187-142119209 TGGTATGTTTTTACACTTAAGGG - Intronic
939666193 2:144954527-144954549 TATTATGTATGAACTCTGAGTGG + Intergenic
941944731 2:171082527-171082549 TGATATGTATATATTCTTACTGG - Intronic
942437833 2:176000699-176000721 TGTTATGGAGGTACTGTTGATGG - Intronic
945827694 2:214744365-214744387 TGTTATGCAGGTAATCATAAAGG + Intronic
1170636970 20:18115443-18115465 TGTTATGTGTGTACACATTAAGG + Intergenic
1170975599 20:21160967-21160989 TGTTATTTATGCACTGTTTATGG + Intronic
1171445675 20:25202571-25202593 TGTTATGTATGTAATCCCTATGG - Intronic
1172539880 20:35703289-35703311 TGTTAAGTATGTATTGTAAATGG + Intergenic
1177493597 21:21860859-21860881 TTTTATATATGTACTCTTTAGGG + Intergenic
1178159028 21:29889251-29889273 TGTTAAGTATTTTTTCTTAAAGG + Intronic
1178699549 21:34821252-34821274 TGCTATTTATGTGCTCTTATTGG - Intronic
1179541440 21:42085641-42085663 TGTTATGTGTGTACCCTCATAGG + Intronic
951077526 3:18414280-18414302 TGCTGTGAATCTACTCTTAAAGG - Intronic
952588032 3:34916671-34916693 TGTTAGGTACGTACTATGAATGG + Intergenic
954901424 3:54023381-54023403 TGTCATATATGTACTCACAAGGG - Intergenic
955045036 3:55351712-55351734 TGTTTTGCATGTATTATTAATGG - Intergenic
955278402 3:57570016-57570038 TGTTGTGTGTGTAGTCTTATGGG - Intergenic
955694828 3:61625245-61625267 TGTTACGTATGTACTGTGATGGG - Intronic
956081911 3:65566329-65566351 TATTATCTATGTACTCAGAAAGG + Intronic
959855111 3:111144566-111144588 TTTTAAGTTTGTACTCTAAAAGG - Intronic
960190441 3:114698198-114698220 TGTTCTTTATGTATTTTTAAAGG - Intronic
962561428 3:136610807-136610829 TGTTGTGTATGCACAATTAATGG + Intronic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
967091432 3:186137974-186137996 TGTTTTGCTTATACTCTTAATGG - Intronic
967237093 3:187396005-187396027 TTGTATTTTTGTACTCTTAAAGG + Intergenic
967380092 3:188848182-188848204 TGTTATGTATGTACCCATTGTGG + Intronic
973387985 4:49527781-49527803 TTTTGGGTATATACTCTTAAAGG + Intergenic
975036406 4:69688830-69688852 TGTTGTGTATGTACGTTGAAGGG - Intergenic
975146791 4:70976469-70976491 TTTTTTGTATTTACTTTTAAGGG + Intronic
976204432 4:82611029-82611051 TTTTATGTATTTACTCTTCAGGG + Intergenic
978120050 4:105067768-105067790 TGTTATGTTTGTACTAGTAAAGG + Intergenic
979608677 4:122667505-122667527 TGTTATGAATTCACTCTTCAGGG + Intergenic
979929267 4:126610604-126610626 TTTTATTTATGTATTCTTAATGG - Intergenic
980952282 4:139393301-139393323 TGTGATGTATGATATCTTAAGGG + Intronic
981594981 4:146409809-146409831 AGTTATGTGTTTACTTTTAATGG + Intronic
983002000 4:162426659-162426681 TGTCATAAATGTACTATTAAAGG + Intergenic
986980360 5:13440913-13440935 TGTTATGTTTATACTGTAAATGG + Intergenic
987378462 5:17260114-17260136 TGTTATTTATTTGCACTTAACGG - Intronic
991427980 5:66511194-66511216 TGTTATGTATGTGCTTTTCTGGG - Intergenic
993049147 5:82905951-82905973 AGTTATGTTTTTTCTCTTAATGG - Intergenic
993183180 5:84581852-84581874 TCCTATTTATGTTCTCTTAAAGG + Intergenic
994442537 5:99828373-99828395 TGTTCTGTATTTGATCTTAAAGG + Intergenic
994656308 5:102597612-102597634 TGTTAATTATGTATTGTTAAGGG - Intergenic
994885996 5:105562699-105562721 TGTTGTGAATGTATTCTGAAAGG - Intergenic
994901441 5:105776718-105776740 TGTTATGTCTGTATTAATAAGGG + Intergenic
997669653 5:135660065-135660087 TTTTATGTATGCACAATTAAAGG - Intergenic
998438200 5:142132097-142132119 TGTTATGTATGTACTCTTAAGGG + Intronic
999400557 5:151260719-151260741 TGTTATGTATGTAATTGTATGGG - Intronic
1000897494 5:166873400-166873422 TGTTTTCTATGTACTATGAAAGG + Intergenic
1003295398 6:4821812-4821834 TTTAATCTATGTACTCTGAAAGG - Intronic
1008182588 6:48350842-48350864 TGTTTTATATTTAGTCTTAATGG + Intergenic
1008778451 6:55070455-55070477 TGTTATTTATGTAAACATAATGG - Intergenic
1008783503 6:55137234-55137256 TGTTTTGTATCTACTCTGAAGGG - Intronic
1010009117 6:71029305-71029327 TTTTTTGTATATACTCTTAATGG + Intergenic
1012039878 6:94190521-94190543 TTTTATGTATGTGCTATAAAAGG + Intergenic
1012097551 6:94982689-94982711 TGTATTGTATGTACACATAAGGG - Intergenic
1012247881 6:96946230-96946252 TATTATATATCTATTCTTAATGG - Intronic
1012442966 6:99278914-99278936 TGTGATGTATTTTCTCTCAAAGG - Exonic
1013405028 6:109835636-109835658 TCTTATTTATTTACTCTTGAAGG + Intergenic
1017861314 6:158400328-158400350 TGTAATGTATATACTTTTATTGG - Intronic
1020440991 7:8216205-8216227 TGTTATGTATGTGCTCATTTGGG + Intronic
1021161746 7:17282047-17282069 TGTTTTATATGTAGTGTTAAGGG - Intergenic
1022195053 7:28056892-28056914 TGATATATATGTATTCATAAAGG - Intronic
1022886705 7:34654181-34654203 TTTTATATATGTATTTTTAATGG - Intergenic
1024247077 7:47478833-47478855 TGTTATGCATGTAATTTTATTGG - Intronic
1026215267 7:68342887-68342909 TGTTAAGTATGTTCCCTTTAGGG + Intergenic
1026380614 7:69795787-69795809 TGTTATGTATGTACCATTGCTGG + Intronic
1028544956 7:91987509-91987531 TGTTATGTATGGATTCACAACGG + Intronic
1032315293 7:130832458-130832480 TGTTTTGTAAGTACACTTAAAGG + Intergenic
1033487014 7:141800880-141800902 TGGTGTTTATGTAGTCTTAATGG - Intergenic
1039739322 8:40366963-40366985 TGTTATGTCTATAATCATAAAGG + Intergenic
1041028831 8:53715234-53715256 TGCCATGTATGTACTGCTAAAGG + Intergenic
1041823500 8:62065468-62065490 TTTTATGTATTTACTATTACCGG - Intergenic
1042058925 8:64796382-64796404 TTTCATGTATTTACTTTTAAAGG - Intronic
1042278785 8:67032376-67032398 TGTGCTGTATGTACTCTGGAAGG - Intronic
1042469684 8:69171006-69171028 TGTCATGTCTTTAATCTTAAAGG + Intergenic
1043342906 8:79262907-79262929 TGATATTTCTGTACTCTTTATGG - Intergenic
1043637061 8:82398690-82398712 TGTTAGTTATGTAGTCATAATGG - Intergenic
1044077821 8:87845427-87845449 TGTTATGTATCTTCTTATAAGGG + Intergenic
1045413170 8:101940355-101940377 TGTTATATATGTCCACATAAGGG - Intronic
1047552734 8:125894211-125894233 CTTTCTCTATGTACTCTTAAGGG - Intergenic
1052384819 9:27810064-27810086 TGTTATTTAGATAATCTTAATGG + Intergenic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1056900129 9:90591347-90591369 TGTTATGAATGTTATCTAAAAGG + Intergenic
1058122101 9:101150057-101150079 TTTTATATATGTGCTTTTAATGG + Intronic
1059836212 9:118156742-118156764 TGGTTTGGATGTCCTCTTAATGG + Intergenic
1061524379 9:131146592-131146614 TGTTATGTAACTGCTCTTCATGG - Intronic
1188384362 X:29538300-29538322 TGTAATATATATAATCTTAAAGG + Intronic
1188540993 X:31250163-31250185 TGTGATATATGCACTCTTTATGG - Intronic
1190782186 X:53608505-53608527 TGTTATGTTGGTACTCAAAAAGG + Intronic
1192103415 X:68289827-68289849 TATTAAGTATGTCCACTTAATGG + Intronic
1194154849 X:90375072-90375094 TGTGATTTTTGTACTTTTAATGG - Intergenic
1195769411 X:108333793-108333815 TGTTTTGTAGATACTGTTAATGG - Intronic
1196143135 X:112287574-112287596 TATTCTGTCTGTACTCTCAAGGG + Intergenic
1196280319 X:113816433-113816455 TGTGAGGTAGGTACTGTTAATGG - Intergenic
1197081405 X:122422099-122422121 TTCTATGTATTTACTCCTAAAGG - Intergenic
1197137466 X:123079460-123079482 TGTTATGTTTGTAGACTGAAAGG - Intergenic
1197189612 X:123631342-123631364 TGTTATGTATACACTCTGAAGGG - Intronic
1198362592 X:135910437-135910459 TGTTATTTATCTTCTCTTCACGG - Exonic
1198500198 X:137236812-137236834 TGTTATTTATTTACTTTTACTGG + Intergenic
1199119551 X:144035368-144035390 TGCTGTGAATGTACTTTTAAAGG + Intergenic
1199586140 X:149418326-149418348 TGTTGTGCATATATTCTTAAGGG - Intergenic
1201785640 Y:17774982-17775004 TTTTAAGTATGTATTCTTATAGG - Intergenic
1201815913 Y:18131006-18131028 TTTTAAGTATGTATTCTTATAGG + Intergenic