ID: 998439151

View in Genome Browser
Species Human (GRCh38)
Location 5:142141818-142141840
Sequence CAATTTATTAAACACCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998439151_998439157 0 Left 998439151 5:142141818-142141840 CCTGGCAGGTGTTTAATAAATTG 0: 1
1: 0
2: 3
3: 33
4: 199
Right 998439157 5:142141841-142141863 AGGACCTGGGCCAGGCATGGTGG 0: 1
1: 7
2: 110
3: 755
4: 4561
998439151_998439155 -8 Left 998439151 5:142141818-142141840 CCTGGCAGGTGTTTAATAAATTG 0: 1
1: 0
2: 3
3: 33
4: 199
Right 998439155 5:142141833-142141855 ATAAATTGAGGACCTGGGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 277
998439151_998439156 -3 Left 998439151 5:142141818-142141840 CCTGGCAGGTGTTTAATAAATTG 0: 1
1: 0
2: 3
3: 33
4: 199
Right 998439156 5:142141838-142141860 TTGAGGACCTGGGCCAGGCATGG No data
998439151_998439160 27 Left 998439151 5:142141818-142141840 CCTGGCAGGTGTTTAATAAATTG 0: 1
1: 0
2: 3
3: 33
4: 199
Right 998439160 5:142141868-142141890 CGCCTGTAATCCCAGCATTTTGG 0: 4469
1: 137853
2: 283836
3: 246810
4: 275164
998439151_998439161 28 Left 998439151 5:142141818-142141840 CCTGGCAGGTGTTTAATAAATTG 0: 1
1: 0
2: 3
3: 33
4: 199
Right 998439161 5:142141869-142141891 GCCTGTAATCCCAGCATTTTGGG 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998439151 Original CRISPR CAATTTATTAAACACCTGCC AGG (reversed) Intronic
900803131 1:4749723-4749745 CCCTTCATGAAACACCTGCCTGG - Intronic
902566392 1:17314407-17314429 CCATTTATGATACACCTACCTGG - Intronic
902628589 1:17691116-17691138 CATTTTATTAATGACCTGTCTGG - Intronic
904633036 1:31857481-31857503 AAATGTATTAAAGACCAGCCAGG + Intergenic
904993312 1:34611577-34611599 TAATTTATTAAACAATTGACAGG + Intergenic
905687818 1:39921497-39921519 CAGTTTGTTAAACATTTGCCAGG + Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908081307 1:60581758-60581780 CTATTTATTAGAGACCTGCAAGG + Intergenic
908985845 1:70020147-70020169 TCATTTATTACACTCCTGCCTGG - Intronic
909413319 1:75378518-75378540 CAATCTATTAAACAGCTTCCAGG - Intronic
909566845 1:77062162-77062184 TTATTTATTAAGCACCTACCAGG + Intronic
910723525 1:90314005-90314027 TGAATTATTCAACACCTGCCAGG - Intergenic
913528849 1:119718726-119718748 CCATTTATTGAGCACCTGCTGGG - Intronic
915062054 1:153194392-153194414 CACTTCATTAAACACTTGCTGGG + Intergenic
915272679 1:154766391-154766413 CCATTTATTAAATACTAGCCAGG + Intronic
915736237 1:158087382-158087404 CAATTTATTACACACCTACCAGG - Intronic
916009528 1:160692209-160692231 CAATCTATTATACAGCTTCCAGG - Intronic
916653610 1:166852927-166852949 CAATTTATTCAACACCAACGAGG + Exonic
923824569 1:237485703-237485725 ATATTTATTAAGCACCTACCAGG - Intronic
924617144 1:245621422-245621444 CACTTTATTAAGCACCTGGAAGG - Intronic
1063531120 10:6832197-6832219 CAATCTATTACACAGCTTCCAGG + Intergenic
1064863865 10:19857016-19857038 TAATTTATTAAACACTTGTATGG + Intronic
1065201068 10:23313666-23313688 CAAGTTATTAACCACCTCCCTGG - Intronic
1065465555 10:26017053-26017075 CCATTTATTGACCACCTCCCAGG - Intronic
1066355893 10:34683586-34683608 CAAGTTATTAAGCCCCAGCCTGG + Intronic
1067332067 10:45331652-45331674 CAAGTTCTTAAACACCTACAAGG - Intergenic
1067930020 10:50551330-50551352 CATTCTATGAAACACCTGACTGG + Intronic
1067994175 10:51251220-51251242 CAATTTATGAAACAGGTGCCTGG - Intronic
1069072052 10:63998955-63998977 CACTGTAGTAAACACCTGCAGGG + Intergenic
1075831217 10:125413279-125413301 CAATTTACTCAAAACATGCCAGG - Intergenic
1076993092 11:285630-285652 CAATTAACTAAGCACCTACCTGG + Intergenic
1080015074 11:27496213-27496235 CAATTTTTTAAAGCTCTGCCAGG + Exonic
1080537063 11:33231869-33231891 CAGTTTCTTGAAGACCTGCCTGG + Intergenic
1081301229 11:41454472-41454494 ATATTTATTAAGCACCTACCAGG - Intronic
1085723518 11:78933822-78933844 ACATTTATTGAGCACCTGCCAGG - Intronic
1086295064 11:85357065-85357087 CAATTTATTGAGCACCTACTTGG - Intronic
1087705436 11:101485661-101485683 AAAGTTATTTATCACCTGCCTGG + Intronic
1087723859 11:101696495-101696517 CAATCTATTAAACAGCTTCCAGG - Intronic
1088770149 11:113026759-113026781 TCATTTATTAAGCACCTGCTAGG + Intronic
1089471979 11:118728721-118728743 CAATCTATTAAACAGCTTCCAGG + Intergenic
1090212123 11:124928499-124928521 CAATTTACTAAACTCCAGCATGG - Intronic
1090494399 11:127195798-127195820 ATATTTATTAAACACCAGCAGGG - Intergenic
1092552531 12:9519140-9519162 GAATTTATTACACACCTGCATGG + Intergenic
1093022209 12:14214227-14214249 CATTTAATTAAACACTTGCCAGG + Intergenic
1093731429 12:22569848-22569870 CAATTTAAAAAAAACCTGCTTGG + Intergenic
1094519588 12:31171472-31171494 GAATTTATTACACACCTGCATGG - Intergenic
1096548112 12:52355155-52355177 GTATTTGTTAAACACCTGCTAGG + Intergenic
1097331322 12:58335461-58335483 CAATCTATTATACAGCTTCCAGG + Intergenic
1098970742 12:76853606-76853628 TAATTTATTAAACACTTTACAGG - Exonic
1100421118 12:94434807-94434829 CAGTTTATTAAGCACCTTCAAGG - Intronic
1101729632 12:107416302-107416324 CCTTTTATTGAGCACCTGCCAGG + Intronic
1102135588 12:110571469-110571491 CAATCTATTAAACAGCTTCCAGG - Intronic
1102426934 12:112851127-112851149 CAATTTATTAAGCACTTACTAGG + Intronic
1104665366 12:130643692-130643714 ACATTTATTGAACACCTGCGTGG + Intronic
1106230413 13:27817092-27817114 CAATTTAAAAAACACCCCCCAGG + Intergenic
1107203161 13:37747219-37747241 CCATTTAGTAAGCATCTGCCAGG + Intronic
1107625139 13:42274184-42274206 CATTTTATTAATCAACTACCTGG + Intronic
1108591063 13:51913338-51913360 CTATTTTTTAAAAACCTTCCTGG - Intergenic
1109652519 13:65348225-65348247 CACTGTATTCAACAGCTGCCTGG + Intergenic
1109779636 13:67092292-67092314 TAATTTTTTAAAAATCTGCCAGG - Intronic
1111920443 13:94404563-94404585 CCATTTATTAAAAATTTGCCAGG + Exonic
1113635883 13:111918894-111918916 CAAGTTTTTACTCACCTGCCTGG + Intergenic
1113895738 13:113763510-113763532 CAATTTGTTAAAAACCTGAAAGG - Intronic
1114894108 14:26964196-26964218 CAATTTATTCTAAACCTCCCTGG - Intergenic
1117025712 14:51617963-51617985 AAATTTATTATATACCTGCACGG + Intronic
1121717037 14:96083830-96083852 CTATTAAATAAATACCTGCCGGG + Intronic
1121737584 14:96229130-96229152 CCATTTATTAAACACCTACTAGG + Intronic
1124994425 15:34709092-34709114 GTATTTTTTAAACATCTGCCAGG + Intergenic
1125396229 15:39251145-39251167 CCATTTATTAGGCACCTACCAGG - Intronic
1126528461 15:49685381-49685403 CAATATAGGAAACTCCTGCCAGG + Intergenic
1126721203 15:51582106-51582128 CCATTTATTAAAAACCTACTGGG + Intronic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1129853134 15:78806426-78806448 CATTTTACAAAACACATGCCTGG - Intronic
1130249831 15:82292663-82292685 CATTTTACAAAACACATGCCTGG + Intergenic
1131247529 15:90808525-90808547 CAAGTTCTTAAACAGCAGCCAGG + Intronic
1134005020 16:10813142-10813164 ATATTTATTCAACATCTGCCAGG - Intronic
1135391379 16:22096265-22096287 ATACTTATTGAACACCTGCCAGG - Intronic
1136395901 16:29992222-29992244 CAGTTTATTAAAAGCTTGCCTGG - Intronic
1138384930 16:56629744-56629766 CTATTTATTAAACCCTAGCCAGG - Intergenic
1139410722 16:66758222-66758244 ACATTTATTAAGCACCTGCTAGG - Intronic
1141076973 16:81015707-81015729 AAATTCATTAAGCACCTGGCTGG + Intronic
1143987216 17:10925350-10925372 GTATTTATAAAACACCTGTCAGG + Intergenic
1144528791 17:16015893-16015915 CAATTTATGAAGGACCTTCCTGG + Intronic
1146890974 17:36506379-36506401 ATATTTATTGAGCACCTGCCGGG - Intronic
1147606069 17:41774302-41774324 GAAATTATAAAACATCTGCCAGG - Intronic
1153518175 18:5924462-5924484 CAAGATATTAACCACCAGCCAGG + Intergenic
1155988092 18:32251997-32252019 CAAGTTATTAAACACCTTAGAGG - Intronic
1160159819 18:76462461-76462483 CACCTCATTAAAGACCTGCCTGG + Intronic
1160294296 18:77623255-77623277 CAATTTCTTTAACACCGGCACGG + Intergenic
1160334223 18:78023152-78023174 CAATTTACTAAACAACTACTTGG + Intergenic
1164153815 19:22576362-22576384 CAATCTATTACACAGCTTCCAGG - Intergenic
1164371217 19:27645967-27645989 CAATCTATTATACAGCTTCCAGG + Intergenic
1164960122 19:32420744-32420766 CAATTTATTAAACACATGGCAGG - Intronic
1165591109 19:36970631-36970653 AAATTTATTAAAGACATGGCCGG - Intronic
1166075078 19:40409425-40409447 GTATTTATAAAGCACCTGCCAGG - Intronic
1166320689 19:42016797-42016819 CACTTTACCAAACACCTCCCAGG - Intronic
1166346013 19:42166391-42166413 CTATTTATTGAGTACCTGCCAGG - Intronic
1202671124 1_KI270709v1_random:53137-53159 CAATTAATAACACACCTGCGAGG + Intergenic
925107249 2:1302252-1302274 TAATTTAGTAAACACAGGCCGGG - Intronic
926025217 2:9537193-9537215 CCATTTATTGAACACCTACTTGG + Intronic
926586703 2:14694058-14694080 ATATTTACTAAACACCTACCAGG - Intergenic
927419953 2:22920162-22920184 GAATTTAGTAAACAGCAGCCAGG + Intergenic
929399739 2:41566316-41566338 CAATTTGTTAAATAACAGCCAGG + Intergenic
932557816 2:72841107-72841129 CCATTTATGAAGCACCTGCTGGG + Intergenic
934852102 2:97707917-97707939 ACATTTATTGGACACCTGCCGGG + Intergenic
938017598 2:127880427-127880449 CACTTTATTTGACACCTGCAAGG - Intronic
939322810 2:140646277-140646299 CAATCCATTAAAAACCTGGCAGG + Intronic
942287322 2:174433064-174433086 CAGTTTTTTAAAAACCTGCATGG - Exonic
942855288 2:180538788-180538810 CAATTCATGAAACATCTCCCCGG + Intergenic
943203023 2:184854279-184854301 CAATTTATTCAACATCCCCCAGG + Intronic
944396753 2:199276705-199276727 CAATTTATGAAAAAGCTGGCAGG + Intronic
944917242 2:204373614-204373636 ACATTTATTAAACACATACCTGG - Intergenic
944988167 2:205203180-205203202 CAATTTAGTAAAAATCTGCGTGG - Intronic
948228231 2:236329688-236329710 AAATTTATTAAACATCTACTTGG + Intronic
1169011047 20:2250768-2250790 CAATTTTATAAACAGCTTCCAGG - Intergenic
1169021329 20:2333311-2333333 CAATATATGAAGCAACTGCCTGG + Intronic
1169607224 20:7335599-7335621 AAATTTATTAAACACATTCTTGG + Intergenic
1170879115 20:20278861-20278883 ATATTTATTGAACACCTGCTAGG + Intronic
1170943547 20:20869294-20869316 ATATTTATTAAATATCTGCCTGG + Intergenic
1171485662 20:25483790-25483812 CACTTTCTTAGACACCTCCCAGG + Intronic
1172945631 20:38686182-38686204 AAAGTTACTAATCACCTGCCTGG - Intergenic
1173738274 20:45377328-45377350 CAAGTTTTTTAACACCTGCCAGG + Exonic
1174577137 20:51544510-51544532 ATATTTATTGAGCACCTGCCTGG + Intronic
1175148443 20:56913870-56913892 CAATTTAGTGAGCACCTGCTGGG + Intergenic
1177249005 21:18568354-18568376 CAATCTATTAAACAGCTTCTAGG + Intergenic
1178812385 21:35895951-35895973 CCACTTATTAAACATCTACCCGG - Intronic
1179952324 21:44715718-44715740 TAAATTATTAAAAACCAGCCTGG - Intergenic
1180837866 22:18940106-18940128 CAATCTATTAAACAGCTTCCAGG - Intergenic
1181598269 22:23932619-23932641 CCATTTATTAAAAAGCTGACTGG + Intergenic
950139609 3:10606348-10606370 CCATCTATTAAACACAAGCCAGG - Intronic
950593240 3:13954567-13954589 CAATTTTTTAAAAACCAGCTTGG - Intronic
951599539 3:24358079-24358101 ATATTTATTAAACATCTACCAGG - Intronic
951696133 3:25447486-25447508 ACATTTATTGAGCACCTGCCAGG - Intronic
953378996 3:42452400-42452422 ATATTTATTAACCACTTGCCAGG + Intergenic
953720716 3:45352496-45352518 CCATTTATTAAGCACCTGCCTGG + Intergenic
955196268 3:56807326-56807348 GTATGTATTAAACATCTGCCTGG - Intronic
957499391 3:81034367-81034389 CAAATTATTGAACACCTAACTGG + Intergenic
959070001 3:101693326-101693348 CAATCTATTACACAGCTTCCAGG - Intergenic
961004183 3:123393666-123393688 CCATGTAGTAAGCACCTGCCGGG - Intronic
961296854 3:125891726-125891748 CAATCTATTAAACAGCTTCCAGG - Intergenic
963696075 3:148567123-148567145 CAATCTATTAAACAGCTTCCAGG + Intergenic
965460449 3:168955462-168955484 CTATTGATTTAACATCTGCCAGG - Intergenic
966002039 3:174961493-174961515 TAATTTATAAAACACCGGGCAGG + Intronic
966601245 3:181777205-181777227 CAATGTAATAAACCCCTGCATGG + Intergenic
966659238 3:182396055-182396077 CCATTTATTAAGCATCTCCCAGG - Intergenic
967101182 3:186217032-186217054 CTATGCATTAAACACCTGCTTGG - Intronic
967150145 3:186640768-186640790 CAATACAGAAAACACCTGCCAGG - Intronic
970109726 4:12624308-12624330 CTATTTATTAAACACCTTACAGG + Intergenic
971169763 4:24221264-24221286 CAATTTATTGAACACTTACCAGG + Intergenic
972209398 4:36818994-36819016 CATTTTATTAAGCACCTGCTGGG + Intergenic
972924709 4:43989494-43989516 GAATTTATTAAGCACCTACTAGG - Intergenic
974135784 4:57815676-57815698 CCATTTATTGAATGCCTGCCAGG + Intergenic
974707514 4:65540666-65540688 GAATTTATTGAACCCCTGGCTGG + Intronic
974844120 4:67330514-67330536 CAATTTATTTATCACCACCCTGG - Intergenic
975609017 4:76185672-76185694 CAATTTATCAAACACCTCTGAGG - Intronic
976333432 4:83858152-83858174 AAATTTACTCAACATCTGCCTGG + Intergenic
978299951 4:107256806-107256828 CAATTTCTTAAACTCATGTCAGG - Intronic
978949698 4:114543055-114543077 CAGATTATAAAACACCAGCCAGG + Intergenic
979187382 4:117814351-117814373 ATATTTATTAAACTCCTTCCAGG + Intergenic
979370547 4:119880991-119881013 CAATTTATGAAATATCTGGCTGG - Intergenic
980131799 4:128823222-128823244 CAATCTATTAAACCCCTTCCAGG - Intronic
980468976 4:133225752-133225774 CAATTTATAAAACAACTGAATGG + Intergenic
981191172 4:141865170-141865192 TCAGTTATTAAACATCTGCCTGG - Intergenic
981434884 4:144708777-144708799 CAATTCATTTAAAACCTACCAGG - Intronic
982435635 4:155381537-155381559 CAATTTACAAAACACCTTCCGGG + Intergenic
982476285 4:155855291-155855313 AAAATTTTTAGACACCTGCCTGG + Intronic
982876712 4:160660050-160660072 CAATCTATTATACAGCTTCCAGG - Intergenic
983175173 4:164579706-164579728 TAATTAATTAAACAGTTGCCTGG + Intergenic
983816592 4:172136400-172136422 CAATTTTTTAAAAACATACCTGG + Intronic
983826241 4:172265095-172265117 CAATTTCTTAAGCACCTTGCTGG + Intronic
988031920 5:25773189-25773211 CAATTTATTAGAAACTTGGCTGG + Intergenic
988380779 5:30494661-30494683 CAATCTATTAAACAGCTTCCAGG + Intergenic
989226045 5:39029918-39029940 TAATGTGTTAAACACTTGCCTGG - Intronic
993172782 5:84441206-84441228 CAATTGATAAAACTCTTGCCAGG + Intergenic
993390270 5:87312545-87312567 CAATTTTTTAAACATCTGAACGG + Intronic
993654847 5:90564919-90564941 AAATATATTAAACGCCGGCCGGG - Intronic
995356476 5:111243059-111243081 TAATGTTTTAAACATCTGCCCGG - Intronic
995439659 5:112176257-112176279 CAATTAATAAAATACCTGCTGGG - Intronic
997952272 5:138252073-138252095 CCATTTATTGAACACCTGCTTGG - Intergenic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
998722493 5:144970208-144970230 CAATTTATTAAATTTATGCCAGG - Intergenic
999952476 5:156665431-156665453 CAATCTATTAAACAGCTTCCAGG + Intronic
1003354100 6:5349805-5349827 CATTCTACTAAACACCTGACAGG - Intronic
1003544043 6:7043599-7043621 CAAATTATTAAAAAGTTGCCGGG + Intergenic
1007253653 6:40513542-40513564 CAATTTTTTGAACACCTACTAGG + Intronic
1008518910 6:52344508-52344530 ATATTTATTACACACCTGGCTGG - Intergenic
1008615817 6:53224502-53224524 CAAAATATTATTCACCTGCCAGG + Intergenic
1008756331 6:54798869-54798891 AAATTTATTATACACCTGATTGG - Intergenic
1010170787 6:72972729-72972751 CAATTTATTGAACACCTACTAGG - Intronic
1011693308 6:89888989-89889011 CGATTTCATAAACAACTGCCTGG - Intergenic
1011748526 6:90432390-90432412 ACATTTATTAAACACCTACTAGG - Intergenic
1012294323 6:97501680-97501702 CCATTTATCAAACACCGACCAGG + Intergenic
1015983895 6:138866679-138866701 CAATTTTTTAAATAACTGCATGG + Intronic
1016024621 6:139273385-139273407 CAATTTATGAAACACCTGTAGGG - Intronic
1019976936 7:4590443-4590465 CAATCTATTATACAGCTTCCAGG + Intergenic
1019977871 7:4598946-4598968 CAATCTATTATACAGCTTCCAGG + Intergenic
1019988534 7:4676161-4676183 CAAATGATTAAACCCATGCCTGG + Intergenic
1023725173 7:43136114-43136136 TAATTTAGTAAACATCAGCCTGG - Intronic
1026502075 7:70951487-70951509 CAATCAATTTAACACCAGCCAGG + Intergenic
1029967221 7:104752336-104752358 CAATCTATTAAACAGCTTCCAGG + Intronic
1031385236 7:121141708-121141730 ATATTTATTAACCACCTGCCAGG - Intronic
1032760128 7:134932832-134932854 CATTTTAGTACACGCCTGCCTGG - Intronic
1033482469 7:141755626-141755648 CAATCTATTAAACAGCTTTCAGG + Intronic
1034231256 7:149530338-149530360 CAAATTCTTAAACACCTGAGGGG + Intergenic
1036292480 8:7505891-7505913 CAATCTATTAAACAGCTTCCAGG + Intronic
1036459599 8:8940148-8940170 AAATTTTTTAAACATCTCCCAGG + Intergenic
1038069123 8:23993750-23993772 CAATTGTTTCATCACCTGCCGGG - Intergenic
1038155617 8:24986826-24986848 CTATTTATTAAGCACCTCCCAGG + Intergenic
1039040436 8:33402898-33402920 CAATTTTTTAAAAATCAGCCAGG + Intronic
1039914581 8:41850437-41850459 CTATTTATTGAACATCTGCCAGG - Intronic
1040439519 8:47426667-47426689 AAATTTATTTCTCACCTGCCTGG + Intronic
1040941399 8:52836984-52837006 CAGTTTATTGGACACATGCCAGG + Intergenic
1043541334 8:81266406-81266428 CAATTTACTATCCACCAGCCAGG + Intergenic
1044570944 8:93717822-93717844 ATATTTATTAAAAACTTGCCTGG + Intronic
1044970255 8:97612637-97612659 AAATTTATTGAGCACCTGCCAGG + Intergenic
1046525400 8:115376502-115376524 TTATTTATTACACACCTGCTCGG + Intergenic
1047471337 8:125176190-125176212 CAATTTATTAAACAAAGACCTGG + Intronic
1048427940 8:134339942-134339964 ATATTTATTTAACACCTTCCTGG + Intergenic
1048580865 8:135728975-135728997 GAATCTCTCAAACACCTGCCTGG - Intergenic
1048947447 8:139462507-139462529 CAATCTATTAAACAGCTTCCAGG + Intergenic
1050811067 9:9748356-9748378 CAATTTATTAAACACTTCTATGG - Intronic
1050815339 9:9804585-9804607 AAATTTATTCAACACCTACTAGG - Intronic
1052108937 9:24555443-24555465 TAATTTAATAAACTCCTGACAGG + Intergenic
1056032973 9:82572202-82572224 CCATTTATTAAAAAGCAGCCTGG + Intergenic
1056655994 9:88509617-88509639 CCATTTATTAAATGCCTGCCAGG + Intergenic
1059772252 9:117438252-117438274 CAGTTTATTAAACACGTGTAGGG - Intergenic
1059963734 9:119592920-119592942 ATATTTATAAAACACCTGCTAGG + Intergenic
1059967950 9:119634579-119634601 AATTTTATTACACACATGCCAGG - Intergenic
1187520838 X:20012509-20012531 CAATGGATTGAACACCTGCCAGG - Exonic
1187588734 X:20692596-20692618 GAATGTATTAAACACCTCCGGGG + Intergenic
1188185656 X:27111182-27111204 CTATTTATTAAACAACTGTTTGG + Intergenic
1188337463 X:28955181-28955203 CATTTTATCAAACACGTGACAGG + Intronic
1188655323 X:32687234-32687256 CACTTTATTGAACACCTGTTAGG + Intronic
1196207801 X:112960911-112960933 ATATTTATTAGACACCTGCTAGG + Intergenic
1198112559 X:133514552-133514574 CATTTTCTGAACCACCTGCCAGG + Intergenic
1198623826 X:138545431-138545453 CTATTTATTAAATGCTTGCCAGG + Intergenic