ID: 998442461

View in Genome Browser
Species Human (GRCh38)
Location 5:142173921-142173943
Sequence GGAGAACAGCACCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998442455_998442461 25 Left 998442455 5:142173873-142173895 CCGCACACTTTTAAACAACTAGA 0: 36
1: 732
2: 1268
3: 2006
4: 2265
Right 998442461 5:142173921-142173943 GGAGAACAGCACCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998442461 Original CRISPR GGAGAACAGCACCAAGGGGA TGG Intergenic
No off target data available for this crispr