ID: 998444229

View in Genome Browser
Species Human (GRCh38)
Location 5:142186291-142186313
Sequence ACCAGTGATTCTTAACTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998444229_998444236 18 Left 998444229 5:142186291-142186313 CCAAAAAGTTAAGAATCACTGGT No data
Right 998444236 5:142186332-142186354 CACCGAAGAGTGCTATAGAATGG No data
998444229_998444237 19 Left 998444229 5:142186291-142186313 CCAAAAAGTTAAGAATCACTGGT No data
Right 998444237 5:142186333-142186355 ACCGAAGAGTGCTATAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998444229 Original CRISPR ACCAGTGATTCTTAACTTTT TGG (reversed) Intergenic
No off target data available for this crispr