ID: 998444236

View in Genome Browser
Species Human (GRCh38)
Location 5:142186332-142186354
Sequence CACCGAAGAGTGCTATAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998444229_998444236 18 Left 998444229 5:142186291-142186313 CCAAAAAGTTAAGAATCACTGGT No data
Right 998444236 5:142186332-142186354 CACCGAAGAGTGCTATAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998444236 Original CRISPR CACCGAAGAGTGCTATAGAA TGG Intergenic
No off target data available for this crispr