ID: 998446733

View in Genome Browser
Species Human (GRCh38)
Location 5:142204645-142204667
Sequence CTGGAGACACAGTGTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998446733_998446742 2 Left 998446733 5:142204645-142204667 CCAACCCCACACTGTGTCTCCAG No data
Right 998446742 5:142204670-142204692 CCAGAAGACAGCCTCCCGGATGG No data
998446733_998446739 -2 Left 998446733 5:142204645-142204667 CCAACCCCACACTGTGTCTCCAG No data
Right 998446739 5:142204666-142204688 AGGCCCAGAAGACAGCCTCCCGG No data
998446733_998446743 3 Left 998446733 5:142204645-142204667 CCAACCCCACACTGTGTCTCCAG No data
Right 998446743 5:142204671-142204693 CAGAAGACAGCCTCCCGGATGGG No data
998446733_998446744 4 Left 998446733 5:142204645-142204667 CCAACCCCACACTGTGTCTCCAG No data
Right 998446744 5:142204672-142204694 AGAAGACAGCCTCCCGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998446733 Original CRISPR CTGGAGACACAGTGTGGGGT TGG (reversed) Intergenic
No off target data available for this crispr