ID: 998447392

View in Genome Browser
Species Human (GRCh38)
Location 5:142208946-142208968
Sequence AAACTGGAGCTCTCACACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998447392_998447394 -1 Left 998447392 5:142208946-142208968 CCACGGTGTGAGAGCTCCAGTTT No data
Right 998447394 5:142208968-142208990 TCTGCCTCCTCCCCAGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998447392 Original CRISPR AAACTGGAGCTCTCACACCG TGG (reversed) Intergenic
No off target data available for this crispr