ID: 998449956

View in Genome Browser
Species Human (GRCh38)
Location 5:142226561-142226583
Sequence ACCAGGGCTTTTAGGGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998449944_998449956 23 Left 998449944 5:142226515-142226537 CCAGTGACCAACCATAATGCAAT No data
Right 998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG No data
998449947_998449956 12 Left 998449947 5:142226526-142226548 CCATAATGCAATAGCCAAAGGAG No data
Right 998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG No data
998449950_998449956 -2 Left 998449950 5:142226540-142226562 CCAAAGGAGGGTGTCCTAAAAAC No data
Right 998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG No data
998449945_998449956 16 Left 998449945 5:142226522-142226544 CCAACCATAATGCAATAGCCAAA No data
Right 998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998449956 Original CRISPR ACCAGGGCTTTTAGGGCACT TGG Intergenic
No off target data available for this crispr