ID: 998452166

View in Genome Browser
Species Human (GRCh38)
Location 5:142243319-142243341
Sequence CTGTATCTGCATATTATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998452164_998452166 -2 Left 998452164 5:142243298-142243320 CCTCTCTTATTAATTCAAACGCT No data
Right 998452166 5:142243319-142243341 CTGTATCTGCATATTATTTTGGG No data
998452163_998452166 14 Left 998452163 5:142243282-142243304 CCAGCAATCTTGCAGACCTCTCT No data
Right 998452166 5:142243319-142243341 CTGTATCTGCATATTATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998452166 Original CRISPR CTGTATCTGCATATTATTTT GGG Intergenic
No off target data available for this crispr