ID: 998452670

View in Genome Browser
Species Human (GRCh38)
Location 5:142246771-142246793
Sequence CTCCCAGCCAGAGTTTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998452670_998452674 1 Left 998452670 5:142246771-142246793 CCCATGGAAACTCTGGCTGGGAG No data
Right 998452674 5:142246795-142246817 CAGACACGGAAGACCCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998452670 Original CRISPR CTCCCAGCCAGAGTTTCCAT GGG (reversed) Intergenic
No off target data available for this crispr