ID: 998455526

View in Genome Browser
Species Human (GRCh38)
Location 5:142269704-142269726
Sequence CTGAAGTGGGGGAGGGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998455513_998455526 17 Left 998455513 5:142269664-142269686 CCTAAATCTTCTACTGAGGCAAG No data
Right 998455526 5:142269704-142269726 CTGAAGTGGGGGAGGGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998455526 Original CRISPR CTGAAGTGGGGGAGGGGATC TGG Intergenic
No off target data available for this crispr