ID: 998457073

View in Genome Browser
Species Human (GRCh38)
Location 5:142281499-142281521
Sequence CTTTGGCTGCACCATGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998457068_998457073 14 Left 998457068 5:142281462-142281484 CCTTTTGCAGTTTGGAATCTATC No data
Right 998457073 5:142281499-142281521 CTTTGGCTGCACCATGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998457073 Original CRISPR CTTTGGCTGCACCATGTTGT GGG Intergenic