ID: 998457366

View in Genome Browser
Species Human (GRCh38)
Location 5:142283686-142283708
Sequence CCGGGGCTGTTGGATGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998457355_998457366 23 Left 998457355 5:142283640-142283662 CCACAGCCTGTTTCCTCATCTAT 0: 2
1: 2
2: 25
3: 148
4: 615
Right 998457366 5:142283686-142283708 CCGGGGCTGTTGGATGACATGGG No data
998457356_998457366 17 Left 998457356 5:142283646-142283668 CCTGTTTCCTCATCTATAAATGG No data
Right 998457366 5:142283686-142283708 CCGGGGCTGTTGGATGACATGGG No data
998457358_998457366 10 Left 998457358 5:142283653-142283675 CCTCATCTATAAATGGTGAGAGC No data
Right 998457366 5:142283686-142283708 CCGGGGCTGTTGGATGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998457366 Original CRISPR CCGGGGCTGTTGGATGACAT GGG Intergenic
No off target data available for this crispr