ID: 998458029

View in Genome Browser
Species Human (GRCh38)
Location 5:142288847-142288869
Sequence TTGTGGAGAAGGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998458029_998458036 17 Left 998458029 5:142288847-142288869 CCAGCCTCCCTCCTTCTCCACAA No data
Right 998458036 5:142288887-142288909 TCTTTCTCACCCAGATAGTAAGG No data
998458029_998458039 28 Left 998458029 5:142288847-142288869 CCAGCCTCCCTCCTTCTCCACAA No data
Right 998458039 5:142288898-142288920 CAGATAGTAAGGCAGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998458029 Original CRISPR TTGTGGAGAAGGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr