ID: 998459305

View in Genome Browser
Species Human (GRCh38)
Location 5:142297620-142297642
Sequence CTGTGTCAGGGGTTGGCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998459296_998459305 -4 Left 998459296 5:142297601-142297623 CCTCTTCCATTTCTTCTACCTGT No data
Right 998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG No data
998459295_998459305 5 Left 998459295 5:142297592-142297614 CCTAGAACTCCTCTTCCATTTCT No data
Right 998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG No data
998459294_998459305 6 Left 998459294 5:142297591-142297613 CCCTAGAACTCCTCTTCCATTTC No data
Right 998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG No data
998459297_998459305 -10 Left 998459297 5:142297607-142297629 CCATTTCTTCTACCTGTGTCAGG No data
Right 998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998459305 Original CRISPR CTGTGTCAGGGGTTGGCGAG GGG Intergenic
No off target data available for this crispr