ID: 998461738

View in Genome Browser
Species Human (GRCh38)
Location 5:142314859-142314881
Sequence GACGCCCGCCCGCTGTGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 56}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998461738_998461742 -9 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461742 5:142314873-142314895 GCGGGCGTCGGGGCCAGCTCTGG 0: 1
1: 0
2: 0
3: 8
4: 194
998461738_998461758 28 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461758 5:142314910-142314932 TCCGCTTTGGGCCGGTGGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
998461738_998461746 4 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461746 5:142314886-142314908 CCAGCTCTGGGGCCCCGCCCCGG 0: 1
1: 0
2: 6
3: 50
4: 436
998461738_998461757 23 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461757 5:142314905-142314927 CCGGGTCCGCTTTGGGCCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 65
998461738_998461750 16 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461750 5:142314898-142314920 CCCCGCCCCGGGTCCGCTTTGGG 0: 1
1: 0
2: 2
3: 8
4: 101
998461738_998461743 -8 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461743 5:142314874-142314896 CGGGCGTCGGGGCCAGCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 133
998461738_998461744 -7 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461744 5:142314875-142314897 GGGCGTCGGGGCCAGCTCTGGGG 0: 1
1: 0
2: 1
3: 20
4: 227
998461738_998461748 15 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461748 5:142314897-142314919 GCCCCGCCCCGGGTCCGCTTTGG 0: 1
1: 0
2: 1
3: 23
4: 137
998461738_998461753 20 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461753 5:142314902-142314924 GCCCCGGGTCCGCTTTGGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 99
998461738_998461760 29 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461760 5:142314911-142314933 CCGCTTTGGGCCGGTGGTCAGGG 0: 1
1: 0
2: 1
3: 7
4: 64
998461738_998461747 5 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461747 5:142314887-142314909 CAGCTCTGGGGCCCCGCCCCGGG 0: 1
1: 0
2: 2
3: 37
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998461738 Original CRISPR GACGCCCGCCCGCTGTGACC AGG (reversed) Exonic