ID: 998461748 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:142314897-142314919 |
| Sequence | GCCCCGCCCCGGGTCCGCTT TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 162 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 23, 4: 137} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 998461738_998461748 | 15 | Left | 998461738 | 5:142314859-142314881 | CCTGGTCACAGCGGGCGGGCGTC | 0: 1 1: 0 2: 1 3: 7 4: 56 |
||
| Right | 998461748 | 5:142314897-142314919 | GCCCCGCCCCGGGTCCGCTTTGG | 0: 1 1: 0 2: 1 3: 23 4: 137 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 998461748 | Original CRISPR | GCCCCGCCCCGGGTCCGCTT TGG | Exonic | ||