ID: 998461748

View in Genome Browser
Species Human (GRCh38)
Location 5:142314897-142314919
Sequence GCCCCGCCCCGGGTCCGCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998461738_998461748 15 Left 998461738 5:142314859-142314881 CCTGGTCACAGCGGGCGGGCGTC 0: 1
1: 0
2: 1
3: 7
4: 56
Right 998461748 5:142314897-142314919 GCCCCGCCCCGGGTCCGCTTTGG 0: 1
1: 0
2: 1
3: 23
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998461748 Original CRISPR GCCCCGCCCCGGGTCCGCTT TGG Exonic