ID: 998462906

View in Genome Browser
Species Human (GRCh38)
Location 5:142322751-142322773
Sequence AAATCTTCATGGACAAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 278}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998462906_998462914 27 Left 998462906 5:142322751-142322773 CCAATATTTGTCCATGAAGATTT 0: 1
1: 0
2: 3
3: 27
4: 278
Right 998462914 5:142322801-142322823 CTACACCCGTACTGGCCACATGG 0: 1
1: 0
2: 0
3: 4
4: 48
998462906_998462908 19 Left 998462906 5:142322751-142322773 CCAATATTTGTCCATGAAGATTT 0: 1
1: 0
2: 3
3: 27
4: 278
Right 998462908 5:142322793-142322815 TCCCCACCCTACACCCGTACTGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998462906 Original CRISPR AAATCTTCATGGACAAATAT TGG (reversed) Intronic
905314997 1:37076734-37076756 TTATCTTCATGTACAAATAGGGG + Intergenic
906420349 1:45661015-45661037 AAATAGTCAAGGAGAAATATAGG + Exonic
907025923 1:51118574-51118596 AAAGCTTTATGTATAAATATTGG + Intronic
907644263 1:56225830-56225852 AAATATTCATGGGAAATTATGGG + Intergenic
907789806 1:57651540-57651562 AACTCTTAAAGGACAAAAATGGG - Intronic
908148637 1:61275431-61275453 TAATATTCATGGATAAATATCGG + Intronic
908360540 1:63365009-63365031 AAATGTTCATGAATAAATAGCGG - Intergenic
908848222 1:68346827-68346849 AAATCCTCATTGATAAAGATGGG - Intergenic
909366228 1:74825874-74825896 AAAGCTTCATGGACGAATTCAGG + Intergenic
910258409 1:85273034-85273056 AAATCTTAAAGGACGAATAGGGG - Intronic
910700214 1:90065647-90065669 AACTATTCATGGTCAAAGATAGG + Intergenic
911001226 1:93168524-93168546 AAATCTTCAGGGATAAAGAGGGG + Intronic
911453361 1:98093816-98093838 AAGTCTTCATGCTCAAATTTAGG - Intergenic
912182466 1:107235759-107235781 AGATCTTCAAGGAAATATATTGG + Intronic
912611759 1:111054107-111054129 AAATGTTAATTGACAAAAATGGG - Intergenic
915264171 1:154703713-154703735 AAATCAGCAGGGAGAAATATGGG - Exonic
916284573 1:163092134-163092156 AAATCTACAAGTAAAAATATTGG - Intergenic
917629988 1:176882013-176882035 AAATCATGATGGAAAAATTTGGG - Intronic
918552249 1:185756649-185756671 AAATATGAATAGACAAATATTGG - Intronic
918565174 1:185921102-185921124 ACATATTCATTGACAAATAATGG + Intronic
919145434 1:193628483-193628505 AAATCTTCATGTAAGAAAATAGG + Intergenic
919311818 1:195918733-195918755 AAATCATCTTAGATAAATATAGG - Intergenic
922366265 1:224867106-224867128 AAATCCTGCTGGACAAATCTTGG - Intergenic
922625085 1:227032390-227032412 CAAGATTCATAGACAAATATAGG + Intronic
924307693 1:242708302-242708324 AAAACTAAATGGAAAAATATTGG - Intergenic
1063064897 10:2598811-2598833 AAGTCTTCATGGACCACTGTGGG - Intergenic
1064835821 10:19528930-19528952 AACTCTTCAGGGACAAGTACTGG + Intronic
1065279097 10:24116548-24116570 AAAACTTTATTTACAAATATAGG + Intronic
1065468508 10:26051764-26051786 AAAACTTCATTCACAAAAATAGG - Intronic
1066002516 10:31117685-31117707 AAAACTTCATTTACAAAAATGGG - Intergenic
1067533301 10:47090222-47090244 AAAACTTTATTGACAAAGATAGG - Intergenic
1070495980 10:77022975-77022997 AAAACTTCAAAGAGAAATATGGG + Intronic
1072297286 10:94022838-94022860 AGATCTTAATGGACAAGGATTGG + Intronic
1073314343 10:102567885-102567907 AAATCTTCAAAGCCAAACATAGG - Intronic
1073816029 10:107207910-107207932 AAATCATCATGGAAATAAATGGG - Intergenic
1075601842 10:123775133-123775155 ACACCTTCATGGACAGATAGGGG - Intronic
1078040395 11:7856226-7856248 AAATTGTCATGTACAAAAATAGG - Intergenic
1078770451 11:14345724-14345746 AAATCTTAATCTCCAAATATGGG - Intronic
1078777622 11:14408305-14408327 AAATCTGCATGGTCAAAGATGGG - Intergenic
1079615962 11:22493626-22493648 TAAACTTCATGGAGAAATACTGG + Intergenic
1080000444 11:27342603-27342625 AAAACTTCATTTACAAATACAGG - Intronic
1080380613 11:31768348-31768370 CACTCTTCATGGACAGATAGAGG - Intronic
1081452828 11:43188979-43189001 AAAATTTCAGAGACAAATATAGG - Intergenic
1081764686 11:45601627-45601649 ATATCATCAGGGACAAAAATGGG - Intergenic
1084397847 11:68925571-68925593 AAATCTACATGAAGAAATAAAGG - Intronic
1085485918 11:76862400-76862422 ACATAATCATGGAGAAATATTGG + Intronic
1085549185 11:77351420-77351442 AAATGTACATGGACAAGCATAGG - Intronic
1086159237 11:83702740-83702762 TGAGCTTCATGGACAAATAAAGG + Intronic
1086384777 11:86295994-86296016 AAACCTTCATGTACAAGTTTTGG + Intergenic
1086816406 11:91377638-91377660 AAATGTTAATGGAGGAATATAGG + Intergenic
1089332136 11:117696961-117696983 GACTCTTCAGGGACTAATATGGG + Intronic
1094045947 12:26167334-26167356 AAAACCTTATGGACAAAGATTGG + Intronic
1095128147 12:38506664-38506686 AAATCATCATGGAGAAATGTTGG - Intergenic
1095276782 12:40294848-40294870 AAATCTTCATGATCAAAAATGGG - Exonic
1096343161 12:50820659-50820681 AAATCTTCTTGGAAAAACTTTGG - Exonic
1096417004 12:51423380-51423402 AGATTTTGATGGACAAAAATGGG + Intronic
1096899279 12:54858014-54858036 AAATCTTTAAGGACAGAAATTGG + Intronic
1098444221 12:70549924-70549946 AAATGTTTATGAACAAATACGGG - Intronic
1098770369 12:74544672-74544694 AAATCTTTCTAGAAAAATATAGG + Exonic
1099396131 12:82142959-82142981 AAATATTTACTGACAAATATGGG - Intergenic
1100471025 12:94893159-94893181 AAAACTTCATTTACAAAAATAGG + Intergenic
1100646172 12:96533631-96533653 AAATCTTAGTGGGCAAATACAGG - Intronic
1103065303 12:117892598-117892620 AAAACTTTATTTACAAATATAGG - Intronic
1109675414 13:65669507-65669529 AAATCTTTAAGGACACATATAGG - Intergenic
1111206558 13:85019061-85019083 AAAACTGAATAGACAAATATAGG + Intergenic
1111508272 13:89224795-89224817 ATATTTTGATGGACAGATATAGG - Intergenic
1111837536 13:93407299-93407321 AAATATTAATTGACAAATCTAGG + Intronic
1112645698 13:101329173-101329195 ATATCTGTATGCACAAATATAGG + Intronic
1112842248 13:103594535-103594557 AAATGTTCATGGAGAAAGAGCGG + Intergenic
1113022755 13:105906438-105906460 AAATTTTAACAGACAAATATTGG - Intergenic
1113128288 13:107005595-107005617 AAAGCTTCAAAGAGAAATATAGG - Intergenic
1115417571 14:33154068-33154090 ATCTCTTTATGGAAAAATATAGG + Intronic
1116101553 14:40444413-40444435 AAATATTAGTGGACTAATATAGG + Intergenic
1116381982 14:44280830-44280852 AAATCTTAATGAAATAATATTGG - Intergenic
1117759090 14:59007579-59007601 AAATCTTCAAGGAGTAAAATGGG - Intergenic
1117866247 14:60152578-60152600 AAATCTTCATGGAAAATTGGGGG - Intronic
1118457596 14:65958835-65958857 AAAACTTCAGGTACAAACATAGG - Intronic
1120535833 14:85693542-85693564 AAAATTTCATGAACAAATTTAGG - Intergenic
1124558527 15:30749258-30749280 AAAACTTCATTTACAAAAATGGG + Intronic
1124672723 15:31656372-31656394 AAAACTTCATTTACAAAAATGGG - Intronic
1125167321 15:36722814-36722836 AAATCTTCATGGATACGTAATGG + Intronic
1125203156 15:37120139-37120161 AAATCTTCTTTGCCTAATATTGG + Intergenic
1126020023 15:44391025-44391047 AAATCTTCATGAGCCAATTTAGG - Intronic
1128826219 15:70719854-70719876 AAATCTTACTGGATAAATGTAGG - Intronic
1129194987 15:73958641-73958663 AAATATTAATAGAAAAATATGGG + Intergenic
1131267434 15:90925307-90925329 AAATCTTCTTTGACAAAGAATGG + Intergenic
1131910142 15:97189655-97189677 AAAACTTCTTGGAAAAATATAGG - Intergenic
1134407312 16:13972275-13972297 ATATGTTCATGGATAAATATTGG - Intergenic
1135852147 16:25973487-25973509 AACTCTTCATGGGCACATCTTGG - Intronic
1137339517 16:47586511-47586533 TAATTTTCATGTACAAACATGGG + Intronic
1137849117 16:51721006-51721028 AAATTTTCATATACAAATCTAGG - Intergenic
1138875873 16:60948416-60948438 AAAACTTAATGGACAAAACTTGG - Intergenic
1139637759 16:68268628-68268650 AAATTTTCATGGGGAAATTTTGG + Intronic
1140583794 16:76262823-76262845 AAATCTTGAGGTTCAAATATGGG + Intergenic
1141056215 16:80817031-80817053 AAATCCTCATGGACAGAGAATGG + Intergenic
1144607846 17:16683684-16683706 AAATCAACATGGACAAGAATCGG + Intergenic
1146413585 17:32610977-32610999 AAATCTTCAAGGCCAAAGAAGGG - Intronic
1147517819 17:41138770-41138792 GAATTTTCATAGAGAAATATGGG - Intergenic
1148613697 17:48982815-48982837 AAATCTTCTAGGAGAAAAATTGG - Intergenic
1149119875 17:53149876-53149898 AAATCTACTTGAATAAATATAGG - Intergenic
1153568076 18:6440426-6440448 AAATCCTCATGGGGAAATAAAGG - Intergenic
1154067507 18:11121795-11121817 ATATTTTCATGACCAAATATAGG + Intronic
1155099470 18:22594880-22594902 AAATGTTGATGGAAAAAAATAGG + Intergenic
1155313400 18:24546889-24546911 AAATCTTCCTTGACAAATGTTGG + Intergenic
1155794532 18:30018978-30019000 AAGTCTTCAGGGAAAAATACAGG + Intergenic
1157923288 18:51736059-51736081 AAGTCTACTTGGACAAAGATGGG - Intergenic
1158167411 18:54556050-54556072 AATTTTTCATGAAAAAATATTGG - Intergenic
1159253656 18:65916257-65916279 AAATCTACATGGTTAATTATGGG - Intergenic
1159735477 18:72092076-72092098 AAATTTTGATGCACAAAAATGGG - Intergenic
1160602395 18:80023654-80023676 AAATATTCATGGTAACATATGGG - Intronic
1162881045 19:13659681-13659703 CAATCTTCCTGGAGAAAAATTGG - Intergenic
1165220741 19:34314358-34314380 AAATCTATAGGTACAAATATGGG + Intronic
1165849059 19:38838633-38838655 AAAGCTTCAGGGACAACTTTGGG - Intronic
925398192 2:3552279-3552301 AAATCAACATGGACAAGAATCGG - Exonic
928520108 2:32080357-32080379 AAAACTTTATGTACAAAAATAGG + Intronic
929283548 2:40109873-40109895 AAGTCTTCCTGAAAAAATATGGG + Intronic
931129695 2:59321115-59321137 AAATATTTATGTTCAAATATTGG + Intergenic
932032006 2:68197875-68197897 AAATCTTCATGATCAAGGATGGG - Intronic
932534607 2:72579891-72579913 AAAGCTTCTTGGAGAAAGATAGG + Intronic
932624702 2:73288095-73288117 AAATCTACATGGACCAAAATAGG + Intergenic
932738874 2:74276492-74276514 AGATCTCCATGGACAGAGATGGG + Intronic
933855085 2:86405153-86405175 AAAACTTCAGGGACAAATTTAGG - Intergenic
935394340 2:102589892-102589914 GAATCTTAAAGGACAAAAATTGG + Intergenic
939889287 2:147717184-147717206 AAATCTTCATAGAAAAGTACTGG - Intergenic
940430070 2:153579304-153579326 AAATTTTCATGAGCTAATATAGG + Intergenic
940735579 2:157447916-157447938 AAATCTTCTTGTGCAAATAAAGG - Intronic
940913756 2:159231665-159231687 ACACCTTCAAGCACAAATATAGG - Exonic
942049685 2:172127638-172127660 AAATCTAAATGGACAAAATTTGG - Intergenic
942290577 2:174465833-174465855 AAATTTTGTTGGACAAATTTTGG - Exonic
942625073 2:177891720-177891742 AAAACTTTATTGACAAAAATAGG - Intronic
942916342 2:181312409-181312431 AGATCTTCATAGACAATTTTGGG + Intergenic
943811132 2:192191008-192191030 AAATACTCAAGGGCAAATATAGG + Intronic
943968149 2:194365929-194365951 ATATTTTAATGGACTAATATAGG - Intergenic
944397652 2:199287405-199287427 AAGTCTTCATTGACAATTCTTGG - Intronic
944512247 2:200476333-200476355 ATATTATCTTGGACAAATATAGG - Intronic
944984908 2:205165408-205165430 AAATCATTCTGGAAAAATATGGG - Intronic
1169495484 20:6110903-6110925 AAATCAACAGGGACAAACATTGG + Intronic
1170420947 20:16192742-16192764 AAATCTTGATGGTTAAATGTTGG + Intergenic
1171141066 20:22743051-22743073 AAATCTTCATGGATGTCTATAGG + Intergenic
1173944501 20:46940096-46940118 AAATCTTCATGGAGGAAGAAAGG + Intronic
1174184412 20:48695932-48695954 AAAACTTTATTGACAAAAATAGG + Intronic
1175352604 20:58335936-58335958 AAATGATCCTGGACAAAGATAGG - Intronic
1177226447 21:18263449-18263471 AAATCTTGCTGGTAAAATATAGG - Intronic
1177381215 21:20346994-20347016 AATTCTTCAGGAACATATATTGG - Intergenic
1177574919 21:22941017-22941039 AAATCTGCATAGATAAATATTGG + Intergenic
1178557270 21:33603678-33603700 AATTATTCATGGGCAAATAATGG - Intronic
1180121637 21:45754145-45754167 AAATTTTAATGGAAAAATATTGG + Intronic
1180873728 22:19163834-19163856 AAATTTTCATGATGAAATATTGG - Intergenic
1185013306 22:48328474-48328496 TAATCTTCATGTTCAAATTTTGG + Intergenic
949200222 3:1368363-1368385 AAATCTTTTTAGAAAAATATTGG + Intronic
950298117 3:11849374-11849396 ATATATTCATAGAAAAATATTGG - Intergenic
952052059 3:29395920-29395942 AAATATCAATGGACAAATCTAGG + Intronic
952325376 3:32315697-32315719 AAAGGTTCATGGTCAAATCTGGG - Intronic
956711976 3:72047123-72047145 AAGCCTTCAAGCACAAATATTGG - Intergenic
957178146 3:76839872-76839894 ATTTCTTCATGGATAAATCTTGG + Intronic
959792825 3:110385010-110385032 ATATCTTCATGGGAAAATTTAGG - Intergenic
959820868 3:110733841-110733863 AAATCTTTATTTACAAAAATAGG + Intergenic
960193252 3:114732676-114732698 AAGTCTTCATGGGAAAATAAAGG - Intronic
961405339 3:126675040-126675062 AAATCTTCATGGACAAAATTAGG - Intergenic
963553985 3:146762087-146762109 AAATCTTCATGGAATAGAATGGG + Intergenic
964533981 3:157699438-157699460 AAATTTTCATGGACAAGGTTTGG - Intergenic
965331214 3:167377156-167377178 AAACCATCATGGACAATTTTGGG - Intronic
965755205 3:172018910-172018932 AACTCTTTATAGACAAATGTGGG - Intergenic
965763895 3:172109803-172109825 AAAACTTCATAGACAACTTTAGG - Intronic
966565743 3:181378880-181378902 AAAACTGCATGGGAAAATATAGG - Intergenic
967065477 3:185911517-185911539 AAATCTTCAAGAACAAAGACGGG - Intergenic
967125499 3:186419793-186419815 AAAGCTTCCTAGGCAAATATGGG + Intergenic
967544286 3:190705694-190705716 AAATCCTAATTGGCAAATATTGG - Intergenic
968888909 4:3356008-3356030 AAATCTTCATGCAAATATAAAGG + Intronic
969167352 4:5328545-5328567 AAAGCTTCATGGATAAAGGTTGG - Intronic
969587980 4:8105511-8105533 AAATCATCATGCTCAATTATCGG + Intronic
970152579 4:13105494-13105516 AATTCTTCATGAACAAAACTTGG - Intergenic
970588875 4:17541434-17541456 AAATATACATGGACATATTTAGG - Intergenic
970634908 4:17998565-17998587 AAATCTTCAGGGGCAATAATAGG + Intronic
970927346 4:21468067-21468089 AAAGCTTACTGGAGAAATATAGG + Intronic
970953001 4:21778027-21778049 AATTCTTCAAGAACCAATATAGG + Intronic
971354580 4:25883771-25883793 AAAACTTTATTGACAAAAATAGG + Intronic
972425876 4:38932315-38932337 AATTCTTCATGGACAAGAAGAGG + Exonic
973127851 4:46610575-46610597 AAAACTTCATGGACCAGTAGTGG - Intergenic
974517203 4:62932728-62932750 AAATCCCCATGGACAATTCTTGG - Intergenic
974710962 4:65594675-65594697 ATATGTTGATGGACAAATACGGG - Intronic
976676124 4:87705368-87705390 AAATTTTCATGATGAAATATTGG - Intergenic
977069726 4:92369771-92369793 AAATCTTATTTCACAAATATGGG + Intronic
980613584 4:135189803-135189825 AAATCTGAATGGGTAAATATGGG - Intergenic
980740225 4:136940631-136940653 TAATATTAGTGGACAAATATTGG - Intergenic
982171118 4:152662721-152662743 AAATCTCCATGGACGATTATGGG - Intronic
982303792 4:153907347-153907369 GAATCTTCATGGAGAAAAACAGG - Intergenic
982504679 4:156202316-156202338 ATATTTTCATAGACACATATAGG + Intergenic
983097589 4:163582494-163582516 AAATCTTCATAGACAAACCTTGG - Intronic
983133209 4:164047581-164047603 ATATCTATATGGTCAAATATGGG - Intronic
983527421 4:168773406-168773428 AAATCTTCATGATTAAATAAAGG - Intronic
983710387 4:170708364-170708386 AAATGTTCAAGAAAAAATATAGG - Intergenic
983825436 4:172252330-172252352 AAATCTTCATCTACAACTCTGGG + Intronic
984080938 4:175249568-175249590 AAATCTTCATGTACATAGATAGG + Intergenic
986417067 5:7539802-7539824 AAAACTTTATGTACAAACATAGG + Intronic
987692081 5:21280218-21280240 TCATCTTCATGGACAAAAATTGG + Intergenic
988994848 5:36705002-36705024 AATTCTCCATGGACCAATACAGG - Intergenic
989212585 5:38870804-38870826 ACATCTTCATGGGCAGAAATAGG + Intronic
989711908 5:44408643-44408665 AAATGTATATGGTCAAATATAGG + Intergenic
990980046 5:61594036-61594058 AAATCTTGAAAGACAAATACAGG - Intergenic
991748297 5:69769874-69769896 TCATCTTCATGGACAAAAATTGG - Intergenic
991799877 5:70349719-70349741 TCATCTTCATGGACAAAAATTGG - Intergenic
991828720 5:70660319-70660341 TCATCTTCATGGACAAAAATTGG + Intergenic
991892235 5:71349150-71349172 TCATCTTCATGGACAAAAATTGG - Intergenic
992653924 5:78889655-78889677 AAAAAGTCATGGAAAAATATTGG + Intronic
992898269 5:81266782-81266804 AAATCTTCATGGTGAAAGAAAGG + Intergenic
993002848 5:82399612-82399634 ATATCTTCATTGACAAACAAGGG + Intergenic
993087111 5:83376810-83376832 AAATCTTCAAGGAAAAAAAATGG - Intergenic
993309874 5:86315328-86315350 TAATTTTCATGAACACATATTGG + Intergenic
994442349 5:99825335-99825357 ACACCTTCCTGGACACATATTGG - Intergenic
994471108 5:100209316-100209338 ATATATTTATGTACAAATATTGG - Intergenic
994751920 5:103748742-103748764 AAATCATCAGGGGGAAATATAGG - Intergenic
994946911 5:106405972-106405994 AACTTTTCAGGTACAAATATTGG - Intergenic
995917829 5:117271247-117271269 CAATCTTTATTTACAAATATGGG + Intergenic
997677826 5:135726772-135726794 AAATATTCATGTACATATTTTGG + Intergenic
998462906 5:142322751-142322773 AAATCTTCATGGACAAATATTGG - Intronic
999727653 5:154449834-154449856 AAATGTTGATGTACCAATATAGG - Intronic
1001475372 5:172046812-172046834 AAAACTTTATTTACAAATATAGG + Intronic
1004277088 6:14246594-14246616 TATTCTTCATGGCCAAATCTAGG + Intergenic
1005207732 6:23423654-23423676 AAAACTTAATGTAAAAATATTGG + Intergenic
1008487981 6:52055790-52055812 AAATCCTCATGCACACATGTAGG - Intronic
1008777227 6:55055151-55055173 AAATATTAATAGACAAATCTAGG - Intergenic
1009615831 6:66005366-66005388 AAACCTTCATATACACATATTGG + Intergenic
1009953411 6:70422654-70422676 AAATATGCATGAACAAATTTTGG - Intronic
1010375841 6:75169020-75169042 ACATCTCCATGGACACATGTGGG + Intronic
1012180232 6:96143683-96143705 TAATCTTTTTGGACAAATACTGG - Intronic
1012425431 6:99109021-99109043 AAAACTTTATGTACAAAAATAGG + Intergenic
1012500927 6:99887371-99887393 AAATCTTCCTAGACAACCATAGG - Intergenic
1012779651 6:103541491-103541513 AAAACTTCATTTACAAAAATAGG + Intergenic
1012810899 6:103956792-103956814 AAATATTTTTTGACAAATATTGG + Intergenic
1014966262 6:127756121-127756143 AAATCTACATGTAAAAGTATTGG + Intronic
1015203943 6:130614052-130614074 AACTCTTCACGGGCAAAGATGGG - Intergenic
1015474402 6:133644021-133644043 TAATATTAATGGACAAAAATCGG + Intergenic
1015630222 6:135224775-135224797 ACACCTTCAAGAACAAATATTGG - Intergenic
1017502099 6:155035035-155035057 AAAGCTTCGTGGACCCATATAGG - Intronic
1018133633 6:160756647-160756669 AACTCTTCATGTTCATATATTGG + Intergenic
1019653637 7:2174655-2174677 AAAACTACATGAACAGATATGGG - Intronic
1020610372 7:10389099-10389121 AAAACTTCATTTACAAAAATAGG - Intergenic
1021261944 7:18469302-18469324 ACATTTTCATGGTCAAATATGGG + Intronic
1023668633 7:42552879-42552901 ATTTTTTCATGGACAAATGTTGG + Intergenic
1024410459 7:49035227-49035249 AAATATTAGTGGATAAATATTGG + Intergenic
1024423000 7:49191696-49191718 AAATTTTCATGTATAAATATTGG - Intergenic
1026381631 7:69805742-69805764 ACATCTTCATAGAGAAATAAAGG - Intronic
1027381016 7:77609578-77609600 AAGTCTTCATGTAAAAATCTTGG + Intronic
1027690318 7:81337107-81337129 AAATCATCAAGGACATGTATGGG + Intergenic
1028170049 7:87585237-87585259 AAAGCTTCAAGAAGAAATATAGG - Intronic
1028323209 7:89488385-89488407 AAAGCTTTATGTACAAAAATAGG + Intergenic
1028985101 7:97003276-97003298 AAAGCTTCATGGAAAAAGAAAGG - Intergenic
1029028390 7:97442774-97442796 GCATCTTCATGGACAGAAATAGG + Intergenic
1031384211 7:121126666-121126688 AAATTTTTATGGAGAAATCTTGG - Intronic
1031850878 7:126861270-126861292 ATATCTTCATGTACTAACATTGG - Intronic
1032150670 7:129426857-129426879 ATCTCTTTATGGAGAAATATTGG + Intronic
1032302223 7:130697826-130697848 AACTCTTCTTAGACAAATAGTGG - Intergenic
1032717569 7:134523297-134523319 AAATCTCCTTGGATAAATGTAGG + Intergenic
1033074978 7:138240656-138240678 AAAACTTCAAAGAAAAATATAGG + Intergenic
1033263707 7:139866215-139866237 AAATCTTCATGCACAAAGTGTGG + Intronic
1033647588 7:143317132-143317154 AAATTGTCATGGAAAAAGATAGG + Intronic
1033734798 7:144211381-144211403 TAATCTACATGGAAAAATAAAGG - Intergenic
1033748257 7:144339588-144339610 TAATCTACATGGAAAAATAAAGG + Intergenic
1034861786 7:154601748-154601770 AAATCTTTATTTACAAAAATAGG - Intronic
1036129532 8:6096313-6096335 ATATTTTAATGGACAAATGTAGG - Intergenic
1037428078 8:18779159-18779181 ATTTCTTCATGGCCAAATATTGG + Intronic
1038330974 8:26609204-26609226 AAATCCTTCTGTACAAATATGGG - Intronic
1039121258 8:34149868-34149890 AAATTATCATGTACACATATTGG - Intergenic
1039263244 8:35795970-35795992 AAATCTTCATGCAGAAATGGAGG - Intronic
1041822197 8:62049659-62049681 AACTTTTAATGGACACATATTGG - Intergenic
1043102823 8:76067708-76067730 AAATGTCCATGGACAAAAATAGG + Intergenic
1043502090 8:80868421-80868443 AAATCTTCCTGGAAATAAATGGG + Intronic
1043573960 8:81635425-81635447 ATATCTTCTTGGTCAAATAAAGG + Intergenic
1046686650 8:117235241-117235263 AACTTTTCATTGAGAAATATGGG + Intergenic
1047793450 8:128229922-128229944 AAATCTACATAGTCAAATAAAGG - Intergenic
1048339613 8:133528600-133528622 AAAACTTCATTTACAAAAATAGG - Intronic
1048574795 8:135682070-135682092 AAAACTTCATTGACAAAAACAGG + Intergenic
1050006525 9:1137280-1137302 AAGTCTTCATTGAAAAATTTTGG - Intergenic
1050745172 9:8867805-8867827 AAATCTTTATGGAAAACAATGGG + Intronic
1052029006 9:23607370-23607392 AATTCTTCATTGAAAATTATAGG - Intergenic
1052108935 9:24555357-24555379 AATTATTAATGGAGAAATATTGG + Intergenic
1052747842 9:32458191-32458213 AAATCTCCAAAGAGAAATATGGG - Intronic
1053372609 9:37575763-37575785 AAATCTCAAGGGGCAAATATGGG - Intronic
1054946295 9:70799472-70799494 AAATCCTCAGTGAGAAATATGGG + Intronic
1055476454 9:76667908-76667930 AAAACTTTATGGACAAAAATAGG + Intronic
1057132412 9:92663511-92663533 TTCTCTTCATGGAGAAATATTGG + Intronic
1057726759 9:97573358-97573380 ACATCCTCATTGTCAAATATTGG - Intronic
1058093684 9:100835038-100835060 AAATCTTCAAGAATAAATGTTGG + Intergenic
1185928808 X:4177495-4177517 AATTTTTAATGGGCAAATATTGG - Intergenic
1186547930 X:10470332-10470354 AAAACTTTATTTACAAATATAGG + Intronic
1187211310 X:17234838-17234860 ATATCTCCAAGTACAAATATGGG - Intergenic
1187305398 X:18090897-18090919 AAGTCATCATCGATAAATATGGG + Intergenic
1187465491 X:19523234-19523256 AAATGTATATGGAAAAATATAGG - Intergenic
1188017721 X:25123384-25123406 AAATCATCATGGACATTTAAAGG - Intergenic
1188929326 X:36087074-36087096 CGACCTTCATGTACAAATATAGG + Intronic
1189130364 X:38491872-38491894 GAACCTTCATGGGCATATATGGG + Intronic
1189185906 X:39054607-39054629 AAATTTTCATACAGAAATATGGG - Intergenic
1189797729 X:44661875-44661897 AAATTTTCATGTACAAATATGGG + Intergenic
1189915194 X:45850109-45850131 AAAAATTCATGAACAACTATCGG + Intergenic
1190094764 X:47469946-47469968 AAATTTCCATGGGCAGATATTGG + Intronic
1190154609 X:47979097-47979119 AAATTTTCATGTAAAAATTTGGG - Intronic
1192224001 X:69216039-69216061 TAATCTCCCTGGACAAGTATAGG - Intergenic
1193200599 X:78685855-78685877 GAATCTTCATGGACAAATTTGGG - Intergenic
1193458947 X:81767006-81767028 AAATATCCATGGACAAATTTAGG + Intergenic
1193478840 X:82000984-82001006 AAGTCTTCTTTGAGAAATATGGG - Intergenic
1193809788 X:86037941-86037963 AAATTTTCAAGATCAAATATGGG - Intronic
1194525771 X:94976047-94976069 AGATCTTCATAGACAAAGAAAGG - Intergenic
1196177105 X:112651118-112651140 AATTCTTCATGTATAAAGATTGG - Intronic
1196311016 X:114165472-114165494 AAATCCTCAGGCACAAATAAAGG - Intergenic
1199503384 X:148534841-148534863 AAAACTACATGGACAAATGTGGG - Intronic
1201577184 Y:15473562-15473584 AAATCTTTATTTACAAATACAGG + Intergenic
1202343779 Y:23898973-23898995 TAATCTTTAAGGACAAACATAGG - Intergenic
1202526989 Y:25771112-25771134 TAATCTTTAAGGACAAACATAGG + Intergenic