ID: 998463230

View in Genome Browser
Species Human (GRCh38)
Location 5:142324495-142324517
Sequence CGTTCGAGGCGGATGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998463219_998463230 7 Left 998463219 5:142324465-142324487 CCTGACCAAGCCCAGAGACGCCC 0: 1
1: 0
2: 1
3: 10
4: 138
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463220_998463230 2 Left 998463220 5:142324470-142324492 CCAAGCCCAGAGACGCCCGTTCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463221_998463230 -3 Left 998463221 5:142324475-142324497 CCCAGAGACGCCCGTTCCAGCGT 0: 1
1: 0
2: 0
3: 1
4: 23
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463216_998463230 25 Left 998463216 5:142324447-142324469 CCGACCCAAACGGTGGCTCCTGA 0: 1
1: 0
2: 0
3: 2
4: 89
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463215_998463230 26 Left 998463215 5:142324446-142324468 CCCGACCCAAACGGTGGCTCCTG 0: 1
1: 0
2: 0
3: 2
4: 79
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463212_998463230 29 Left 998463212 5:142324443-142324465 CCCCCCGACCCAAACGGTGGCTC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463222_998463230 -4 Left 998463222 5:142324476-142324498 CCAGAGACGCCCGTTCCAGCGTT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463218_998463230 20 Left 998463218 5:142324452-142324474 CCAAACGGTGGCTCCTGACCAAG 0: 1
1: 0
2: 0
3: 9
4: 99
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463213_998463230 28 Left 998463213 5:142324444-142324466 CCCCCGACCCAAACGGTGGCTCC 0: 1
1: 0
2: 0
3: 2
4: 54
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463217_998463230 21 Left 998463217 5:142324451-142324473 CCCAAACGGTGGCTCCTGACCAA 0: 1
1: 0
2: 0
3: 3
4: 69
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data
998463214_998463230 27 Left 998463214 5:142324445-142324467 CCCCGACCCAAACGGTGGCTCCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 998463230 5:142324495-142324517 CGTTCGAGGCGGATGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998463230 Original CRISPR CGTTCGAGGCGGATGGTGGC AGG Intronic
No off target data available for this crispr