ID: 998463359

View in Genome Browser
Species Human (GRCh38)
Location 5:142325143-142325165
Sequence CCCATTCATAAAAAAAGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998463359_998463367 10 Left 998463359 5:142325143-142325165 CCGCTCCTTTTTTTATGAATGGG 0: 1
1: 0
2: 2
3: 29
4: 285
Right 998463367 5:142325176-142325198 AGATCTTAACCCGTGATTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 42
998463359_998463368 11 Left 998463359 5:142325143-142325165 CCGCTCCTTTTTTTATGAATGGG 0: 1
1: 0
2: 2
3: 29
4: 285
Right 998463368 5:142325177-142325199 GATCTTAACCCGTGATTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 30
998463359_998463369 16 Left 998463359 5:142325143-142325165 CCGCTCCTTTTTTTATGAATGGG 0: 1
1: 0
2: 2
3: 29
4: 285
Right 998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998463359 Original CRISPR CCCATTCATAAAAAAAGGAG CGG (reversed) Intronic
901787411 1:11633852-11633874 TCCATTTAAAAAAAAAGGGGGGG + Intergenic
902517765 1:16998857-16998879 CACGTTCAGAACAAAAGGAGAGG + Intronic
906732308 1:48093595-48093617 CCCATTCATAAGAGAAAGAATGG + Intergenic
908682204 1:66674728-66674750 CCCATTCAGAAGAAAGGAAGTGG + Intronic
909381979 1:75009226-75009248 ACCATAAATAAAAAGAGGAGGGG - Intergenic
909618417 1:77639247-77639269 CCCATTGAAAAAAAAAGGGAGGG + Intronic
909684752 1:78335280-78335302 GGGATTCATAAAAAAAAGAGTGG - Intronic
909758536 1:79259426-79259448 CAGATTCATAAGAAAAGGATAGG - Intergenic
910510677 1:88000650-88000672 CACATTCATAAAAAAGGGGGAGG - Intergenic
911349549 1:96736688-96736710 CCCTATCTTAAAAAAAGGAAAGG - Intronic
911717833 1:101155192-101155214 CTCATGCTTTAAAAAAGGAGGGG - Intergenic
911791698 1:102025208-102025230 CCCATTCATATAAAAAACACAGG - Intergenic
911996014 1:104767761-104767783 CTCATTCATAAAATAAGGATTGG + Intergenic
914688664 1:150005656-150005678 CCAATTAAAAAAAAAAGGAATGG - Intronic
914821147 1:151104422-151104444 CCCATTCAGAAAAATAGGATTGG - Intronic
915161446 1:153923160-153923182 CCCAATCATAAACGGAGGAGGGG + Intergenic
915909643 1:159906174-159906196 CCCATTAAAAAAAAAAATAGAGG + Intergenic
916648711 1:166815582-166815604 CCCATGCATAAGCAAAGTAGTGG - Intergenic
917410785 1:174758193-174758215 CCAAAACATAAAAAAAGAAGGGG - Intronic
919299303 1:195740183-195740205 TCCATCCAAAAAAAAAGGGGGGG + Intergenic
919695800 1:200573911-200573933 CCCTTTCATATACAATGGAGAGG + Intronic
920210958 1:204327828-204327850 CCCATTCCTAAGGAAAGGACAGG + Intronic
922448779 1:225719716-225719738 GCCATTCATAAAAAAAGTAATGG + Intergenic
922936570 1:229427290-229427312 CCCTGTCTTAAAAAAAGGATGGG + Intergenic
924561361 1:245158278-245158300 CTCATTTAAAAAAAGAGGAGGGG + Intronic
1063229374 10:4048893-4048915 CACATTCATGAAACAAGTAGAGG - Intergenic
1063567282 10:7181820-7181842 CCCTATTAAAAAAAAAGGAGAGG + Intronic
1065194779 10:23253290-23253312 GCCATTCATCAAAAAAGTGGGGG + Intergenic
1066309628 10:34183765-34183787 CCCATACAGAGAAAAGGGAGGGG - Intronic
1067391719 10:45869206-45869228 CCCTGTCAAAAAAAAAGGAAGGG + Intergenic
1067402964 10:45994456-45994478 CCCTGTCAAAAAAAAAGGAAGGG - Intronic
1067470277 10:46532060-46532082 CCAATGCATACAAAATGGAGTGG - Intergenic
1067871572 10:49966936-49966958 CCCTGTCAAAAAAAAAGGAAGGG - Intronic
1069465215 10:68632315-68632337 CCCTTTCAAAAAAAAAAGAAAGG + Intronic
1070087763 10:73253194-73253216 CACCTTAAAAAAAAAAGGAGGGG + Intergenic
1071911902 10:90246002-90246024 CCCTTTTTTAAAAAAATGAGAGG - Intergenic
1073592327 10:104769075-104769097 TCCACTCATGAAAACAGGAGAGG - Intronic
1074516688 10:114176765-114176787 CCCTTTCAGAAAGAAAGGAAAGG + Intergenic
1075763831 10:124877303-124877325 CCATCTCAAAAAAAAAGGAGAGG + Intergenic
1076910074 10:133383179-133383201 CCGTCTCAAAAAAAAAGGAGCGG + Intronic
1078427029 11:11260289-11260311 CCCCATCACAAAAAAAGGGGGGG - Intergenic
1078766217 11:14300992-14301014 CCCTTGCATAGAAAAAGGATAGG + Intronic
1081622256 11:44625510-44625532 CTGGTTCATAAAAAGAGGAGAGG + Intergenic
1081751219 11:45512581-45512603 CCCATTTTAAAAAAGAGGAGAGG - Intergenic
1082813717 11:57494520-57494542 CCCATTAATAACAAAAGTACAGG - Intronic
1083141628 11:60726688-60726710 CCCAATCTTAAAAAAGAGAGGGG - Intergenic
1084441245 11:69174789-69174811 GCCATTCAGAAAAAAAGGCCTGG - Intergenic
1085068239 11:73517903-73517925 TCTATTCAAAAAAAAAGGAGTGG + Intronic
1086173516 11:83862656-83862678 CCCACTCCAAAAAAAAAGAGTGG + Intronic
1086617936 11:88845730-88845752 CCAATTCATATAAAAAGTGGGGG - Intronic
1087263702 11:96039246-96039268 CCAACTCAGAAAAAGAGGAGAGG + Intronic
1088228436 11:107647161-107647183 CCATTTCATAATAAAAGAAGAGG - Intronic
1089520898 11:119062690-119062712 CTCTCTCAAAAAAAAAGGAGTGG - Intergenic
1090211748 11:124925566-124925588 CAGATTCACAAAGAAAGGAGCGG + Intronic
1090228837 11:125087492-125087514 CCCATTCATACATAAAGATGTGG - Intronic
1090664820 11:128907603-128907625 CCCATTCACAGACACAGGAGAGG + Intronic
1092724517 12:11472193-11472215 CCCAGCCTTAAAAAAAGGAGGGG - Intronic
1094865890 12:34529655-34529677 CACATTCATATAAAAAGAAAAGG + Intergenic
1095399504 12:41798404-41798426 GCCGTCCATAAAAAAAGGACAGG - Intergenic
1096009462 12:48200857-48200879 CCCCTTCATAATAAAACAAGGGG - Intergenic
1097048462 12:56205551-56205573 GCCATTCTTAAAAAAAAGAGGGG + Exonic
1097760987 12:63463797-63463819 GCCATTAAAAAAAAAATGAGTGG + Intergenic
1098928724 12:76384086-76384108 CCCACTCATAAATAAAGGTGTGG - Intronic
1099220255 12:79905347-79905369 CTCCTTCAAAAAAAAAGGGGTGG - Intronic
1099876656 12:88416049-88416071 CCCATAAATAAAAAAAGAATTGG + Intergenic
1099957982 12:89369826-89369848 CACATGCCTTAAAAAAGGAGGGG - Intergenic
1100439179 12:94600016-94600038 CCCATCTCTAAAAAAAGGAGTGG + Intronic
1100734322 12:97510297-97510319 CCTATTCATAAAAACCAGAGGGG + Intergenic
1103220105 12:119237012-119237034 CTCATCTATAAAATAAGGAGAGG + Intergenic
1105049139 12:133032137-133032159 CCCATGCATAAAAAAAAAAATGG + Intergenic
1106277447 13:28225729-28225751 CCCATTCAGCAAAAAAGGAGAGG - Intronic
1106968550 13:35105293-35105315 CCCAAGCATAAAAATAGGACAGG + Intronic
1107710389 13:43145280-43145302 CCCCTTCTTAAAAAAAAGGGGGG - Intergenic
1108101183 13:46958140-46958162 TCCATTAAAAAAAAAATGAGGGG - Intergenic
1108236629 13:48414911-48414933 AGCATTAATGAAAAAAGGAGTGG + Intronic
1109536483 13:63728575-63728597 TCCATTCATACAGAAAGAAGGGG - Intergenic
1110453610 13:75665299-75665321 CCCTTTTTTAAAAAAAGAAGAGG - Intronic
1110633740 13:77740533-77740555 TCTATTTATAAAAAAAGGGGGGG - Intronic
1112343833 13:98574841-98574863 CCCACTCAAAAAAAAAAGTGAGG + Intronic
1112704321 13:102049404-102049426 CCCATTCAAAACAAAAAGAAGGG - Intronic
1114912997 14:27223957-27223979 CTCATTCATAAAAAGATTAGGGG + Intergenic
1115009441 14:28527060-28527082 CTCATGCAAAAAAAAAGGGGCGG + Intergenic
1115328262 14:32166313-32166335 CATTTTCATAAAAAAAGAAGTGG + Intergenic
1116501148 14:45623835-45623857 CTCATTTAAAAAAAAAGGAAAGG - Intergenic
1116750114 14:48872576-48872598 CCCATTTAAAAAAAATGGAAAGG + Intergenic
1119596123 14:75935720-75935742 CCCCTTCATATAAAAAGGGGAGG + Intronic
1119781442 14:77278889-77278911 CCCAGTCAGAAGACAAGGAGCGG + Intronic
1122319054 14:100842445-100842467 CCCATTTATGAAAATAGGAGAGG - Intergenic
1123183792 14:106494890-106494912 CACATTCATAAAAAAAAGTGTGG + Intergenic
1202942975 14_KI270726v1_random:100-122 CCCATTAATAAAGAAAATAGGGG - Intergenic
1123736404 15:23188289-23188311 GCCATTCAAAAAAGAAGGAAGGG - Intergenic
1124122952 15:26907658-26907680 CACAGTCAGAAAAAAAGGCGAGG + Intronic
1124287110 15:28411266-28411288 GCCATTCAAAAAAGAAGGAAGGG - Intergenic
1124295592 15:28500366-28500388 GCCATTCAAAAAAGAAGGAAGGG + Intergenic
1126737264 15:51743145-51743167 CCCCATCTCAAAAAAAGGAGGGG - Intronic
1127225301 15:56920564-56920586 CCCATTAAAAATAAAAGCAGTGG - Intronic
1128353363 15:66906910-66906932 CACACTCACAAAAAAAGAAGTGG + Intergenic
1128409157 15:67376306-67376328 ACAATTCATAAAAATAGAAGTGG + Intronic
1128789034 15:70419132-70419154 CACATTAATAAAAAAAGCAAAGG - Intergenic
1129055893 15:72820185-72820207 CCATTTCATAAAAATAGGAAGGG + Intergenic
1129252584 15:74317056-74317078 CCCATTAAGAAAAAGTGGAGTGG + Intronic
1130184459 15:81666641-81666663 TCATTTCAGAAAAAAAGGAGAGG - Intergenic
1130849664 15:87780726-87780748 CCCAGTCAGTGAAAAAGGAGGGG - Intergenic
1132224642 15:100131029-100131051 CGCAGCCATAAAAAAAGGATGGG + Intronic
1133845571 16:9450585-9450607 AACATTCATAAATACAGGAGGGG - Intergenic
1136708855 16:32216320-32216342 CCCATGCCTACAAAAAGAAGTGG - Intergenic
1136759053 16:32713088-32713110 CCCATGCCTACAAAAAGAAGTGG + Intergenic
1136809054 16:33157298-33157320 CCCATGCCTACAAAAAGAAGTGG - Intergenic
1136815530 16:33267378-33267400 CCCATGCCTACAAAAAGAAGTGG - Intronic
1137253071 16:46753969-46753991 TCCATTCTTTAAAAAAGGAGAGG + Intronic
1137728822 16:50674994-50675016 CTCATTCATAAAACAAGGATAGG + Intronic
1137829727 16:51532957-51532979 CCTATTTATAAAATAAGGAGGGG + Intergenic
1138016424 16:53433089-53433111 CCCATTTATAAATCAAGGATTGG + Intergenic
1138309999 16:56015513-56015535 CCCATTCCTTAAAAAATGGGAGG - Intergenic
1138534674 16:57653562-57653584 CCCCCTCATAAAGAAAGGATGGG + Intronic
1203061211 16_KI270728v1_random:973402-973424 CCCATGCCTACAAAAAGAAGTGG + Intergenic
1144577616 17:16438972-16438994 CCCAATCCTCACAAAAGGAGGGG - Intergenic
1146995703 17:37319128-37319150 CACTGTCATAAAAAAAGGTGGGG + Intronic
1152942496 17:83180243-83180265 CCAATTCATAAGAAAAAGACAGG + Intergenic
1153682114 18:7510725-7510747 TCAATTCATCAAAAAATGAGAGG + Intergenic
1154533750 18:15375183-15375205 CCCATTTGTAAAAAAAATAGAGG - Intergenic
1155371889 18:25110763-25110785 CTCTCTCAAAAAAAAAGGAGGGG - Intronic
1155817249 18:30328570-30328592 TCAATTCTTAAAAAAAGGGGGGG + Intergenic
1155951210 18:31915454-31915476 CCCCATCAAAAAAAAAGGGGGGG + Intronic
1155979325 18:32164288-32164310 CCCATTTATATAGAAATGAGAGG + Intronic
1156209198 18:34920369-34920391 ACCATTCCAAAAAAAAGGGGTGG + Intergenic
1156635674 18:39026230-39026252 CCCAATAATAACAAAAGGATGGG - Intergenic
1164109963 19:22147186-22147208 CCCATAAAAAAAAAAAGGACAGG - Intergenic
1165697393 19:37911297-37911319 ACCATTCCCCAAAAAAGGAGGGG + Intronic
1166775011 19:45307190-45307212 CCCATTTATAAAGCGAGGAGTGG - Intronic
1168012307 19:53543118-53543140 ACCATTAGAAAAAAAAGGAGGGG + Intronic
1168647615 19:58070657-58070679 CCCATTTAAAAAACAAGAAGAGG + Intronic
927229514 2:20808296-20808318 TCCATTTTTAAAAAAAGGAAAGG - Intronic
928994059 2:37267536-37267558 CCTATTAAGAAAAAAAGAAGAGG + Exonic
929720584 2:44363378-44363400 CCATTTCAAAAAAAAAGGAGGGG - Intronic
929903015 2:46022237-46022259 CTCATTCATAATAAAAGATGTGG + Intronic
933648831 2:84832798-84832820 TCAATTAAAAAAAAAAGGAGGGG + Intronic
937677368 2:124606924-124606946 AAAACTCATAAAAAAAGGAGAGG + Intronic
941068255 2:160927533-160927555 CCCATTCATTGACAAAGGACAGG + Intergenic
941899727 2:170666655-170666677 ATCATTCAAAACAAAAGGAGGGG + Intergenic
943524737 2:189002541-189002563 CCCAGTCATAAAAGCAGGACAGG - Intronic
943955512 2:194184142-194184164 CTGATAAATAAAAAAAGGAGTGG - Intergenic
944332434 2:198486914-198486936 CCCAATGATTAACAAAGGAGTGG - Intronic
944776861 2:202975718-202975740 CCCATTTATTAAAAAAGGGAGGG - Intronic
945034165 2:205689959-205689981 CTAATCCAGAAAAAAAGGAGGGG + Intronic
945038002 2:205720768-205720790 CCCAATCATAAACAAAGCTGGGG + Intronic
945473367 2:210253039-210253061 CCAATGAATAAGAAAAGGAGAGG - Intergenic
945592415 2:211750250-211750272 TTCATTCATTACAAAAGGAGAGG - Intronic
945876488 2:215283266-215283288 GCCATCTAAAAAAAAAGGAGGGG + Intergenic
946377712 2:219323487-219323509 CCCAATCTCAAAAAAAGCAGGGG - Intergenic
947430969 2:230027383-230027405 CCACTTCTTAAAAAAATGAGTGG - Intergenic
947496054 2:230638011-230638033 CCCTGTCCCAAAAAAAGGAGAGG + Intergenic
949069364 2:242014215-242014237 CCATTGAATAAAAAAAGGAGGGG - Intergenic
1169204946 20:3734159-3734181 CCCTGTCTCAAAAAAAGGAGCGG + Intronic
1169680920 20:8212990-8213012 GCCATTCACAAAGACAGGAGTGG - Intronic
1170558428 20:17534609-17534631 CCTATTAATAAAAACAGAAGGGG + Intronic
1170630080 20:18058055-18058077 TCCTTTCTTAAAAAGAGGAGGGG - Intronic
1172498492 20:35407419-35407441 CCCTGTCAAAAAAAAAAGAGTGG + Intronic
1172792147 20:37513238-37513260 CCCATTTATAAGTCAAGGAGGGG - Intronic
1173987356 20:47272041-47272063 CACAATTATAAAAAAAGGGGGGG + Intronic
1178184843 21:30207677-30207699 CCAATTCAGAAAAAAAATAGGGG + Intergenic
1179216871 21:39374945-39374967 CCCTGTCAAAAAAAAAGGGGGGG - Intergenic
1179374097 21:40834085-40834107 CCAAGTCATAAAAATAGGGGAGG + Intronic
1181911131 22:26239215-26239237 CCCTGTCTCAAAAAAAGGAGGGG + Intronic
1182597251 22:31431331-31431353 CCTATTCAGAAAAAAAAGTGCGG - Intronic
1183757784 22:39785982-39786004 CCTATTCATCAAGAAAAGAGAGG + Intronic
1183985533 22:41568129-41568151 CCCAGTCTCAAAAAAAAGAGAGG - Intronic
949512867 3:4781974-4781996 CCCTGTCTCAAAAAAAGGAGGGG + Intronic
950730346 3:14951005-14951027 TTCAATCATAAAAAAATGAGTGG - Intronic
952455464 3:33467771-33467793 CCGTCTCAAAAAAAAAGGAGGGG + Intergenic
952653265 3:35751970-35751992 CCCACTCATAAGAAAAGAACTGG + Intronic
956490351 3:69764904-69764926 CCCACTGTTAAAACAAGGAGAGG - Intronic
958060786 3:88477145-88477167 GCCTTTCATAAAAAAAGAAATGG + Intergenic
961082898 3:124041744-124041766 GTCATTCATACACAAAGGAGTGG - Intergenic
961696227 3:128707133-128707155 GCCATTCAAAAAAAAAGGCCGGG + Intergenic
962983166 3:140508907-140508929 CCCACTCAAAAAAAAAAGGGGGG - Intronic
964907847 3:161740099-161740121 CCATTTTTTAAAAAAAGGAGTGG - Intergenic
965492525 3:169356808-169356830 CCCATTCTCAAAAGAAGCAGAGG - Intronic
965976504 3:174630490-174630512 CCCATTCAAAAAAACAGGAGTGG + Intronic
966728638 3:183131807-183131829 TTCATTCAGAGAAAAAGGAGAGG - Intronic
968268271 3:197379302-197379324 ACAATTTAAAAAAAAAGGAGTGG - Intergenic
969215305 4:5717268-5717290 TCCATTCATAAAATAAGGACAGG - Intronic
969698050 4:8746712-8746734 CACATTCATAAACACAGGTGCGG + Intergenic
970587201 4:17526073-17526095 ACCATTCATAGAAAAAGGAAAGG - Intronic
971151080 4:24032256-24032278 CTCATTTATAAAAATAGAAGTGG - Intergenic
971593492 4:28498098-28498120 GCCATACATAAAATAAGGAAAGG - Intergenic
971901541 4:32665511-32665533 TCCATTCTGATAAAAAGGAGAGG + Intergenic
972027319 4:34399206-34399228 CCCCCTCAGATAAAAAGGAGGGG - Intergenic
974134814 4:57802161-57802183 CCACCTCATCAAAAAAGGAGGGG + Intergenic
974274811 4:59704931-59704953 CCCATTAAAAAAAAAAAAAGGGG + Intergenic
975090758 4:70401172-70401194 CCCATTTATATAAGAAGCAGAGG + Intronic
975244615 4:72105564-72105586 CACCTTAATACAAAAAGGAGTGG + Intronic
975572426 4:75831795-75831817 CACATTCACAGAAAAAGGAGTGG - Intergenic
975826924 4:78330028-78330050 CACATTTATATAAAAAGAAGGGG + Intronic
975920908 4:79386054-79386076 TCCATTCAGAAAGAAAGGTGAGG - Intergenic
975943307 4:79674371-79674393 ACCATTCATAAAAAAACGCAAGG - Intergenic
976546590 4:86342916-86342938 CCAGTTTAGAAAAAAAGGAGAGG + Intronic
977246625 4:94639173-94639195 CCCATTCACAAGAAAAAGTGAGG + Intronic
977708503 4:100098042-100098064 CACATGCATAAAGAAAGGAGAGG - Intergenic
978664934 4:111171183-111171205 ACCATGCAAAGAAAAAGGAGAGG + Intergenic
979502611 4:121457297-121457319 ATCATTCCTAAAAAAAAGAGAGG + Intergenic
979607260 4:122651778-122651800 GCCATCCATTAAAAAGGGAGGGG - Intergenic
980586872 4:134829560-134829582 CCTATTCATCCAAAAAGGAACGG - Intergenic
981676601 4:147350150-147350172 CTCATTCAGGAAAAAAAGAGAGG + Intergenic
981883846 4:149649194-149649216 CCCCTCCTTAAGAAAAGGAGGGG - Intergenic
981971879 4:150673114-150673136 CTCATCCATAAAACAAGGAGAGG + Intronic
982561741 4:156936389-156936411 CTCATTCCTAACCAAAGGAGAGG + Intronic
982657641 4:158169954-158169976 TCCATTGAAAAAAAAAGGGGGGG + Intronic
983227801 4:165101308-165101330 CTCATTTATAAAAATAGGACAGG - Intronic
983387030 4:167077824-167077846 TCCATTCATAAATATAAGAGAGG + Intronic
985767812 5:1789366-1789388 GCCACTCAGAAAAAAGGGAGAGG - Intergenic
987309172 5:16666431-16666453 CACATGCCTTAAAAAAGGAGGGG - Exonic
987692011 5:21279565-21279587 CCCATTAAAAAAAAATGCAGCGG + Intergenic
989318834 5:40111681-40111703 CACATTTATAAAAAAAGAAAGGG + Intergenic
990562776 5:56999926-56999948 CCCATTAAAAAAAAAAGTGGGGG + Intergenic
991525479 5:67552518-67552540 CTCATTTAGAAGAAAAGGAGAGG - Intergenic
991748371 5:69770527-69770549 CCCATTAAAAAAAAATGCAGCGG - Intergenic
991799951 5:70350372-70350394 CCCATTAAAAAAAAATGCAGCGG - Intergenic
991828649 5:70659666-70659688 CCCATTAAAAAAAAATGCAGCGG + Intergenic
991892306 5:71349803-71349825 CCCATTAAAAAAAAATGCAGCGG - Intergenic
992046698 5:72898885-72898907 ACCTTTCATAAAAAAAGGGTGGG - Intronic
993554058 5:89313880-89313902 CCCATTCTTGAGAAAAGGATAGG - Intergenic
993707443 5:91186982-91187004 CACATTCACAAGAAATGGAGAGG + Intergenic
994167654 5:96624662-96624684 CACATTCATAAACAAGGGATGGG - Intronic
995559871 5:113369108-113369130 TCCATTAAAAAAAAAAGGACTGG - Intronic
997066144 5:130561651-130561673 CCCATTTTTAAAAAATGGGGTGG - Intergenic
997221228 5:132166981-132167003 GCCAATAATAATAAAAGGAGAGG - Intergenic
998323480 5:141256020-141256042 CTCTTTCATAAAAGAAGAAGTGG - Intergenic
998463359 5:142325143-142325165 CCCATTCATAAAAAAAGGAGCGG - Intronic
998611232 5:143691403-143691425 CTCATTAAGAAGAAAAGGAGGGG - Intergenic
999193020 5:149762791-149762813 CCCATCTCTAAAAAAAGGGGTGG - Intronic
999751170 5:154629110-154629132 CCCATGCAGAAGAAAAGCAGTGG + Intergenic
1000694528 5:164363577-164363599 CATATTCATAAAAAAAGAAAGGG + Intergenic
1001799594 5:174531437-174531459 TCCTTTCAAAAAGAAAGGAGTGG - Intergenic
1003705838 6:8527867-8527889 CCCCTTTATAAAAAGAAGAGAGG - Intergenic
1003944736 6:11064356-11064378 CCCTCGCAAAAAAAAAGGAGTGG + Intergenic
1005099432 6:22154153-22154175 CCCAGTTATAAAAACAAGAGCGG - Intergenic
1006609116 6:35282298-35282320 CCCATCTAAAAAAAAAGTAGGGG + Intronic
1006916220 6:37595519-37595541 CGCAGTCATAAAGAAAGCAGAGG + Intergenic
1007277724 6:40687762-40687784 CCCATTGGTAAAAAAGAGAGTGG + Intergenic
1007316816 6:40995843-40995865 CCCATTCAAATAAAAAGTAGGGG - Intergenic
1008076387 6:47150190-47150212 AGCATTCATGAAAATAGGAGTGG + Intergenic
1008698316 6:54068141-54068163 CTCAGTCAAAAAGAAAGGAGAGG - Intronic
1009706917 6:67264250-67264272 CCCATTCATAAAACTAGTAGAGG - Intergenic
1010299682 6:74245192-74245214 ACCATTTATTAAAAAGGGAGTGG + Intergenic
1010902681 6:81447145-81447167 CCCCTTCAAAAAAAAGGGAGTGG + Intergenic
1011114127 6:83871500-83871522 CCCATTCATTAAAAATTTAGTGG + Intronic
1011431630 6:87293584-87293606 GCCAGTAATAAACAAAGGAGTGG - Intronic
1011994577 6:93569050-93569072 CCCACTCATAAAAAATAGAGTGG + Intergenic
1013045937 6:106484983-106485005 CCTATTTAAAAAAAAAGGTGGGG + Intergenic
1013184723 6:107747464-107747486 CCCATTGATAAAAAATTGGGGGG + Intronic
1013820374 6:114147029-114147051 CCCATTCAGAAAAGAAAGAAAGG - Intronic
1015122617 6:129716399-129716421 ACCATTAATAAAAAAAGGCCGGG - Intergenic
1016122307 6:140359066-140359088 CCCATTGCTAAAAAAAGGGAAGG + Intergenic
1016758502 6:147712879-147712901 CCTACTCATACAAAAAGGATTGG + Intronic
1016838051 6:148498872-148498894 CCCATCCATTAAATAAGGACCGG - Intronic
1016933527 6:149431426-149431448 CCCATTCATAATAACAATAGTGG + Intergenic
1018113208 6:160557149-160557171 CCCTTTCATAACAAAGTGAGTGG + Intronic
1019885596 7:3901828-3901850 TCCCTTCCTAAAAAAAGGAATGG - Intronic
1019931683 7:4227507-4227529 GCCATTCATACAAAAAGAAATGG + Intronic
1021346774 7:19539000-19539022 CCCATAAATAAAAAAGGGAAGGG - Intergenic
1022423356 7:30245396-30245418 CACATTAAAAAAAAGAGGAGGGG - Intergenic
1022544990 7:31178115-31178137 CACATTCATAAATAAAGGACTGG - Intergenic
1023338967 7:39199114-39199136 CCAATTCATAAAAAATGCATTGG + Intronic
1026769407 7:73185163-73185185 CACATTGATAAATCAAGGAGTGG - Intergenic
1027010276 7:74738547-74738569 CACATTGATAAATCAAGGAGTGG - Intronic
1027077766 7:75207490-75207512 CACATTGATAAATCAAGGAGTGG + Intergenic
1029920628 7:104258832-104258854 CCATCTCAAAAAAAAAGGAGGGG - Intergenic
1030469831 7:109950028-109950050 CCCATTATTAAAAAAAACAGAGG + Intergenic
1031065136 7:117096461-117096483 GCCTTTCATTAGAAAAGGAGAGG - Intronic
1031390269 7:121204628-121204650 CCCAATGATCCAAAAAGGAGAGG + Intronic
1031596228 7:123652646-123652668 CCCATTCAAATAAAAAAGATGGG + Intergenic
1031868135 7:127062359-127062381 GCCATTTATAAAAGAAGGAATGG + Intronic
1035626510 8:1075164-1075186 CCCACTCATCCGAAAAGGAGGGG - Intergenic
1037947715 8:22999634-22999656 TTCATTCACAAAAAAAGGATAGG - Intronic
1040750490 8:50700003-50700025 CCTATTAATAAATAAAAGAGAGG + Intronic
1040883063 8:52229477-52229499 GCCATTCACCGAAAAAGGAGTGG - Intronic
1041039198 8:53828929-53828951 CCCAATTATGAATAAAGGAGAGG - Intronic
1041823564 8:62066367-62066389 ACTATTCAGAAAAATAGGAGAGG + Intergenic
1044348923 8:91140324-91140346 CCCATTCATTCAAGAAGCAGAGG - Intronic
1044561940 8:93620804-93620826 CCCTTTCTCAAAAAAAGGGGGGG + Intergenic
1044630877 8:94277708-94277730 ACCATTCATGAAAAGAGAAGGGG - Intergenic
1044840545 8:96333308-96333330 CTCATTCATAAATGAAGGCGAGG - Intronic
1045329545 8:101143317-101143339 ACCCTTCATAAAAAAGGGAGGGG + Intergenic
1045559758 8:103249523-103249545 CCCATTTTTTAAAAAAGGAGAGG - Intergenic
1045640139 8:104240696-104240718 CTCATTTATGAAAAAGGGAGGGG - Intronic
1047170120 8:122484592-122484614 GCCATTCTTAAAAGAAGGAAAGG - Intergenic
1049915608 9:315090-315112 CCAATTCAGAAAAAAAGGCTAGG + Intronic
1050092426 9:2028448-2028470 CCCAATCATGAAAAAAGCAAAGG - Intronic
1050250274 9:3736067-3736089 TACAATCATGAAAAAAGGAGGGG + Intergenic
1051962946 9:22790048-22790070 CACATTACTAAAAAAAGGACTGG + Intergenic
1051985590 9:23082999-23083021 TCCATTAAAAAAAAAACGAGAGG - Intergenic
1052832635 9:33228618-33228640 CCCATTCACCATAAAGGGAGGGG + Intronic
1053180965 9:35969887-35969909 CTCATTAAAAAAAAAAGGGGGGG - Intergenic
1055800604 9:80032107-80032129 CTCACTCATCAAAAAAGGAATGG + Intergenic
1056809320 9:89752132-89752154 TCAATTAAAAAAAAAAGGAGCGG - Intergenic
1057747068 9:97760887-97760909 GCCATCCAAAAAGAAAGGAGAGG - Intergenic
1057975862 9:99605502-99605524 TCCTTTTATAAGAAAAGGAGAGG + Intergenic
1059743164 9:117173045-117173067 CTCATTTATAAAATAAGGAAAGG + Intronic
1060607273 9:124926536-124926558 CACATTCACCAAAAAAGGGGAGG + Intronic
1187123963 X:16436003-16436025 CTCATTAAAAAAAAAAGGTGAGG + Intergenic
1187228960 X:17402883-17402905 CCCATTCAAAAGAATAAGAGAGG + Intronic
1187342264 X:18431913-18431935 CCCTGTCTCAAAAAAAGGAGAGG - Intronic
1187923876 X:24232836-24232858 CACATTCATAAAACAAGAACTGG - Intergenic
1188864876 X:35302478-35302500 CAAATACACAAAAAAAGGAGAGG + Intergenic
1189389676 X:40565230-40565252 ACCATTTATGTAAAAAGGAGTGG - Intergenic
1190500930 X:51077960-51077982 CCCAGCAATAAAAAAAGGATCGG + Intergenic
1192852273 X:74969748-74969770 CCTATTCTTAAAAGAAGTAGGGG + Intergenic
1192956653 X:76077939-76077961 CCCATTTAAAAGAAAAAGAGAGG + Intergenic
1193026865 X:76854494-76854516 CTAATTCATAAAAAAAAGACAGG - Intergenic
1194416054 X:93613349-93613371 TCCATTTAGAAGAAAAGGAGTGG + Intergenic
1197479613 X:126966181-126966203 CCCATTTACATAAAAATGAGAGG + Intergenic
1198036292 X:132804498-132804520 CCCATTCATAAGAAAAAGGGGGG + Intronic
1198169823 X:134094750-134094772 CCCTTTCATTAAAAAAGTACTGG - Intergenic
1198416747 X:136428055-136428077 CTCATTCATAAAATAAGTGGTGG - Intergenic
1199732621 X:150651528-150651550 CAAATTCATAAAAAAATGAAAGG + Intronic
1200643305 Y:5749516-5749538 GTCATTGATAAAAACAGGAGAGG - Intergenic