ID: 998463364

View in Genome Browser
Species Human (GRCh38)
Location 5:142325148-142325170
Sequence CGCCCCCCATTCATAAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998463364_998463367 5 Left 998463364 5:142325148-142325170 CCTTTTTTTATGAATGGGGGGCG 0: 1
1: 0
2: 1
3: 4
4: 56
Right 998463367 5:142325176-142325198 AGATCTTAACCCGTGATTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 42
998463364_998463372 27 Left 998463364 5:142325148-142325170 CCTTTTTTTATGAATGGGGGGCG 0: 1
1: 0
2: 1
3: 4
4: 56
Right 998463372 5:142325198-142325220 GGACTGGCTCAAGCTCCACCAGG 0: 1
1: 0
2: 2
3: 18
4: 143
998463364_998463369 11 Left 998463364 5:142325148-142325170 CCTTTTTTTATGAATGGGGGGCG 0: 1
1: 0
2: 1
3: 4
4: 56
Right 998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG 0: 1
1: 0
2: 0
3: 2
4: 46
998463364_998463368 6 Left 998463364 5:142325148-142325170 CCTTTTTTTATGAATGGGGGGCG 0: 1
1: 0
2: 1
3: 4
4: 56
Right 998463368 5:142325177-142325199 GATCTTAACCCGTGATTGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998463364 Original CRISPR CGCCCCCCATTCATAAAAAA AGG (reversed) Intronic
918204063 1:182293515-182293537 TGCGCCCCATTCATGAACAAAGG - Intergenic
924538610 1:244959985-244960007 CGCCCCCCTTTCTTTAAAACGGG - Intergenic
1066414745 10:35211031-35211053 CGCCCAGCATTCATCACAAATGG - Intronic
1067266566 10:44750691-44750713 CTCCCCCCATTCATAATACCTGG - Intergenic
1072279435 10:93852450-93852472 TGCCCCACATTCAGAAGAAAGGG + Intergenic
1084142324 11:67240790-67240812 CGCCCTGCTTTCATCAAAAAAGG - Intronic
1086578262 11:88365327-88365349 CTCCCCCAAAACATAAAAAAGGG - Intergenic
1087218085 11:95516464-95516486 CTCCCCCCATGCATACAAAAAGG - Intergenic
1090014730 11:123075849-123075871 CTCCCACCAGTCATATAAAAGGG + Intronic
1090326336 11:125889202-125889224 CGCCACGCATCCATTAAAAATGG - Intronic
1105298297 13:19109766-19109788 GGTCCCCCATACATAAATAATGG + Intergenic
1112375647 13:98837735-98837757 CGCCCCCCACCCCAAAAAAAAGG - Intronic
1116309552 14:43306124-43306146 GCCACCACATTCATAAAAAAGGG + Intergenic
1127619850 15:60723379-60723401 CCCCCCCCACTCACATAAAATGG + Intronic
1129434447 15:75526997-75527019 CTCCTCACTTTCATAAAAAATGG - Intronic
1130805630 15:87318587-87318609 CGTGCCTCATTCATAAAAAGGGG - Intergenic
1134429226 16:14186033-14186055 CTCCCCCCATGCATTAAAAGCGG - Intronic
1138479069 16:57289941-57289963 CGCCCCCCAGTCAGAAAAAGTGG + Intergenic
1140116275 16:72044124-72044146 TGTGCCCCATTTATAAAAAACGG + Intergenic
1144251387 17:13420063-13420085 TGCCCCCTATTCATAAAAAAGGG - Intergenic
1152353065 17:79794091-79794113 GGCTCCCCAATCAGAAAAAAGGG - Exonic
1160517372 18:79486093-79486115 CCCACCCCATTAAAAAAAAAAGG - Intronic
1161708697 19:5834887-5834909 CTCACCCCATACATGAAAAAAGG - Intronic
931664002 2:64597104-64597126 TGCCCACCAGTCATAAAAACAGG + Intergenic
941050188 2:160723901-160723923 CGCCCGCCATTTATTAAACAGGG + Intergenic
941419694 2:165267903-165267925 CACCTCACATTCATTAAAAATGG + Intronic
943138784 2:183951154-183951176 CTCCCCACATAGATAAAAAAGGG + Intergenic
943712238 2:191109983-191110005 GGGCCCCCATTCATTAAGAAAGG + Intronic
945175629 2:207040667-207040689 CGCCCCCAAATCAGAGAAAATGG + Intergenic
948339581 2:237238648-237238670 TGACCCACATACATAAAAAAGGG - Intergenic
1171977410 20:31604345-31604367 CGTCACCCATTCATAAAACCCGG - Intergenic
1173105493 20:40129575-40129597 ACTCCCCCACTCATAAAAAATGG + Intergenic
1175491031 20:59381412-59381434 GGCCCCCCTTTTATAAAATAGGG + Intergenic
1176545559 21:8196449-8196471 CGGCCCCCCATCCTAAAAAACGG + Intergenic
1176564510 21:8379494-8379516 CGGCCCCCCATCCTAAAAAACGG + Intergenic
1179426836 21:41286892-41286914 GGCCCCCCATTCATGACAACAGG - Intergenic
1182901023 22:33898299-33898321 CGCCCCCCATCCACAAACTAAGG + Intronic
1203250430 22_KI270733v1_random:112686-112708 CGGCCCCCCATCCTAAAAAACGG + Intergenic
961201835 3:125051709-125051731 AACCTCCCATTCATACAAAAAGG + Intronic
962405473 3:135096248-135096270 AGCCCCCCATTTGTAAAAAGGGG - Intronic
980234629 4:130089879-130089901 AGACCCACATTCATAAAATAAGG - Intergenic
986640978 5:9871757-9871779 AGCCCCTTATTCATAAAAAAAGG - Intergenic
992661675 5:78968219-78968241 CCCACCCCCTTCAAAAAAAAAGG + Intronic
992845383 5:80741750-80741772 TGCCCCTCAGTCATTAAAAAGGG - Intronic
998421377 5:141990309-141990331 CTCAACCCACTCATAAAAAAAGG - Intergenic
998463364 5:142325148-142325170 CGCCCCCCATTCATAAAAAAAGG - Intronic
999709401 5:154303103-154303125 CACCCCCCACCCAAAAAAAAAGG + Intronic
1005422219 6:25663694-25663716 TGCCTCCCATTGATAAAAAGGGG + Intronic
1012101938 6:95100973-95100995 TGCCCCCTATTCATATACAATGG - Intergenic
1013353150 6:109324038-109324060 CACCCCCCATTAACAGAAAACGG + Intergenic
1023458000 7:40362422-40362444 CGCTCCCCCCTCAAAAAAAAAGG + Intronic
1025606821 7:63045310-63045332 TTCTCCCCATTTATAAAAAAAGG - Intergenic
1034607467 7:152330222-152330244 TTCTCCCCATTCATTAAAAAAGG - Intronic
1042996810 8:74709428-74709450 CCTCCCCCAATCAAAAAAAAAGG - Intronic
1043711169 8:83420445-83420467 CACCCCCCACTCGTAAAAAAGGG + Intergenic
1046791964 8:118332083-118332105 AGCTCCCCCTTCAAAAAAAAGGG + Intronic
1048826098 8:138428728-138428750 CCCTGCCCATTCATAACAAAGGG + Intronic
1058972457 9:110096048-110096070 CACCCTCCATACATAGAAAAGGG - Intronic
1203466831 Un_GL000220v1:95958-95980 CGGCCCCCCATCCTAAAAAACGG + Intergenic
1189973819 X:46443150-46443172 AGCACCCCATTTACAAAAAAAGG - Intergenic
1194565887 X:95487297-95487319 CACACCCCATAGATAAAAAAAGG - Intergenic
1198480977 X:137040407-137040429 GGTTCCCCATTCATAAAACAAGG - Intergenic