ID: 998463369

View in Genome Browser
Species Human (GRCh38)
Location 5:142325182-142325204
Sequence TAACCCGTGATTGCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998463359_998463369 16 Left 998463359 5:142325143-142325165 CCGCTCCTTTTTTTATGAATGGG 0: 1
1: 0
2: 2
3: 29
4: 285
Right 998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG 0: 1
1: 0
2: 0
3: 2
4: 46
998463364_998463369 11 Left 998463364 5:142325148-142325170 CCTTTTTTTATGAATGGGGGGCG 0: 1
1: 0
2: 1
3: 4
4: 56
Right 998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998463369 Original CRISPR TAACCCGTGATTGCTGGGAC TGG Intronic
900796752 1:4712640-4712662 TTCCCCGTTGTTGCTGGGACTGG - Exonic
902435439 1:16395471-16395493 TAAACTGTTATTGCTGGCACTGG - Exonic
903232701 1:21931576-21931598 TGACCCCTCATAGCTGGGACTGG + Intronic
906167117 1:43694668-43694690 AAACCAGTGATTGCAGGAACTGG - Intronic
910720448 1:90280475-90280497 TAGCCTGTGACTGCTGTGACTGG - Intergenic
916744351 1:167672955-167672977 TATCCCGTGATAGTTGGGATAGG + Intronic
1062808172 10:440791-440813 AAACCCCTGATTGCTGGGCTAGG + Intronic
1064574634 10:16731885-16731907 TAAGCCGATATTGTTGGGACAGG + Intronic
1064777581 10:18795933-18795955 TAATCCGAGGTGGCTGGGACTGG - Intergenic
1077375605 11:2203961-2203983 TAGCCTGTGTCTGCTGGGACTGG + Intergenic
1080577188 11:33610697-33610719 TAGCCCTTCCTTGCTGGGACAGG - Intronic
1091924371 12:4332773-4332795 TAATCCGTCATTGTTGGGACTGG + Intronic
1116949393 14:50865033-50865055 TAACTTGTGATTGCTGGGTTGGG + Intronic
1128203383 15:65829246-65829268 TAATCAATGATTGCTAGGACGGG + Intronic
1132415018 15:101613447-101613469 TCACCAGTGACTGCTGGGCCAGG - Intergenic
1139436357 16:66938876-66938898 TAACCCGTAAGGCCTGGGACAGG - Intronic
1141757670 16:86003121-86003143 AGACCCGTGATTGCCGGGGCTGG - Intergenic
1149915169 17:60601353-60601375 TGACCCGGGATTGCTGGGGTTGG + Intronic
1153133245 18:1882085-1882107 TTACCTGTGATGGCTGGAACTGG + Intergenic
1160766097 19:808757-808779 CATCCCGTGAGTGCTGGGCCGGG + Exonic
1161293330 19:3507074-3507096 CAACCCGTGCCTGCGGGGACTGG - Intronic
1161364066 19:3868456-3868478 TGACCCCTGATTGCTGGTAGGGG - Intronic
1167101694 19:47407635-47407657 TAACCTCTAATTGCTGGAACAGG - Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
925793718 2:7520438-7520460 AAACCCGTAATTCCTGGGAAAGG - Intergenic
926929383 2:18022393-18022415 TAACCCTGGGTGGCTGGGACTGG + Intronic
932760450 2:74436173-74436195 GGATCCGTGAGTGCTGGGACTGG - Intronic
938230057 2:129650634-129650656 TGCCCCGTGGTAGCTGGGACCGG - Intergenic
946202818 2:218080791-218080813 TCACCAGTGATTCCTGGCACTGG - Intronic
947739906 2:232480298-232480320 TCACCCCTGGTTGCTGGGGCTGG - Intronic
1172839056 20:37891074-37891096 TGACCCCAGATTGCTGGGCCTGG - Intergenic
1173506035 20:43587843-43587865 TTCCCCGTGATTCCTGGGGCAGG - Intronic
1178968383 21:37146671-37146693 AGACCAGTGATTGCTGGGCCTGG + Intronic
1184489396 22:44800475-44800497 TACCCCTTGAGAGCTGGGACTGG - Intronic
987083675 5:14448835-14448857 TTACCAGTGATTACTGGGAGGGG - Intronic
991281779 5:64922922-64922944 TAACCCTGGGTGGCTGGGACTGG + Intronic
997284071 5:132665812-132665834 CCACCCGTGAGTGCTGGGAAGGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
998734808 5:145124891-145124913 TGACCCGTCATTCCTGGGGCTGG - Intergenic
1001180135 5:169512692-169512714 TACCTGGTGATTGGTGGGACAGG - Intergenic
1010562631 6:77369243-77369265 TAACACAGGATTGCTGGGAAGGG - Intergenic
1014483190 6:121964426-121964448 TTATCAGTGTTTGCTGGGACTGG - Intergenic
1017029009 6:150204692-150204714 CAACCCGTGAGAGCTGGGGCAGG - Intronic
1020136598 7:5591610-5591632 TAAACTGGGATTGCTGGGGCTGG - Intergenic
1037208718 8:16358292-16358314 TAACCAGAGATTGCTGCAACAGG - Intronic
1044700253 8:94959159-94959181 TAACCTGTGAGTGATGGGGCTGG + Intronic
1048333220 8:133485244-133485266 TGACCAGTGATAGCTGGGACGGG + Intronic
1056859354 9:90165428-90165450 TGTCTCTTGATTGCTGGGACAGG + Intergenic
1189355076 X:40304421-40304443 TAACTCATGAGTGATGGGACAGG - Intergenic