ID: 998463766

View in Genome Browser
Species Human (GRCh38)
Location 5:142326856-142326878
Sequence AGGGTCCTGCACCGGGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998463759_998463766 7 Left 998463759 5:142326826-142326848 CCTCTCTGTCAGCTGTAGAAACT No data
Right 998463766 5:142326856-142326878 AGGGTCCTGCACCGGGTATATGG No data
998463758_998463766 8 Left 998463758 5:142326825-142326847 CCCTCTCTGTCAGCTGTAGAAAC No data
Right 998463766 5:142326856-142326878 AGGGTCCTGCACCGGGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998463766 Original CRISPR AGGGTCCTGCACCGGGTATA TGG Intergenic
No off target data available for this crispr