ID: 998469612

View in Genome Browser
Species Human (GRCh38)
Location 5:142373317-142373339
Sequence CTCAGCTTCCCAAAGTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998469604_998469612 20 Left 998469604 5:142373274-142373296 CCTGGGTTGGTCTCAAACTACTG No data
Right 998469612 5:142373317-142373339 CTCAGCTTCCCAAAGTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998469612 Original CRISPR CTCAGCTTCCCAAAGTGTCC GGG Intergenic
No off target data available for this crispr