ID: 998472859

View in Genome Browser
Species Human (GRCh38)
Location 5:142396868-142396890
Sequence TTTGCAATGCAGAAAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998472848_998472859 30 Left 998472848 5:142396815-142396837 CCAGTCTGATTGGTTGTGGGAGG 0: 26
1: 57
2: 69
3: 91
4: 193
Right 998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG No data
998472853_998472859 4 Left 998472853 5:142396841-142396863 CCAATCAGAGGTGCTTTCCATTT No data
Right 998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998472859 Original CRISPR TTTGCAATGCAGAAAGGGGG TGG Intergenic
No off target data available for this crispr