ID: 998474543

View in Genome Browser
Species Human (GRCh38)
Location 5:142409322-142409344
Sequence AGAGCTGCCCCTGGTCCACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
998474543_998474551 10 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474551 5:142409355-142409377 CTGGCCTGGGGCTGTGCTCACGG No data
998474543_998474548 -3 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474548 5:142409342-142409364 TCTCCAGCAATGGCTGGCCTGGG No data
998474543_998474555 22 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474555 5:142409367-142409389 TGTGCTCACGGAGAGAGGCAGGG No data
998474543_998474546 -9 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474546 5:142409336-142409358 GGCAGCTCTCCAGCAATGGCTGG No data
998474543_998474554 21 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474554 5:142409366-142409388 CTGTGCTCACGGAGAGAGGCAGG No data
998474543_998474549 -2 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474549 5:142409343-142409365 CTCCAGCAATGGCTGGCCTGGGG No data
998474543_998474553 17 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474553 5:142409362-142409384 GGGGCTGTGCTCACGGAGAGAGG No data
998474543_998474547 -4 Left 998474543 5:142409322-142409344 CCGAGTGGACCAGGGGCAGCTCT No data
Right 998474547 5:142409341-142409363 CTCTCCAGCAATGGCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
998474543 Original CRISPR AGAGCTGCCCCTGGTCCACT CGG (reversed) Intergenic
No off target data available for this crispr